NCBI Summary
This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011].
Protein
Protein (NP_659403)
FRAS1 related extracellular matrix 1
FRAS1-related extracellular matrix protein 1 (Protein QBRICK)
FREM1
FRAS1 related extracellular matrix 1
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Proteoglycans or lecticans
a/b mixed / C-type lectin-like
Uncharacterised
Undefined
0.323
Undefined
Protein sequence and protein families (fasta) (2179 amino acids) Download
MNSLSWGAANAVLLLLLLAWASPTFISINRGVRVMKGHSAFLSGDDLKFAIPKEKDACKVEVVMNEPITQRVGKLTPQVFDCHFLPNEVKYVHNGCPILDEDTVKLRLYRFTERDTFIETFILWVYLLEPDCNIIHMSNNVLEVPEFNGLSQAIDKNLLRFDYDRMASLECTVSLDTARTRLPAHGQMVLGEPRPEEPRGDQPHSFFPESQLRAKLKCPGGSCTPGLKKIGSLKVSCEEFLLMGLRYQHLDPPSPNIDYISIQLDLTDTRSKIVYKSESAWLPVYIRAGIPNQIPKAAFMAVFILEVDQFILTSLTTSVLDCEEDETPKPLLVFNITKAPLQGYVTHLLDHTRPISSFTWKDLSDMQIAYQPPNSSHSERRHDEVELEVYDFFFERSAPMTVHISIRTADTNAPRVSWNTGLSLLEGQSRAITWEQFQVVDNDDIGAVRLVTVGGLQHGWLTLRGGKGFLFTVADLQAGVVRYHHDDSDSTKDFVVFRIFDGHHSIRHKFPINVLPKDDSPPFLITNVVIELEEGQTILIQGSMLRASDVDASDDYIFFNITKPPQAGEIMKKPGPGLIGYPVHGFLQRDLFNGIIYYRHFGGEIFEDSFQFVLWDSHEPPNLSVPQVATIHITPVDDQLPKEAPGVSRHLVVKETEVAYITKKQLHFIDSESYDRELVYTITTPPFFSFSHRHLDAGKLFMVDSIPKVVKNPTALELRSFTQHAVNYMKVAYMPPMQDIGPHCRDVQFTFSVSNQHGGTLHGICFNITILPVDNQVPEAFTNPLKVTEGGQSIISTEHILISDADTKLDNIDLSLRELPLHGRVELNGFPLNSGGTFSWGDLHTLKVRYQHDGTEVLQDDLLLEVTDGTNSAEFVLHVEVFPVNDEPPVLKADLMPVMNCSEGGEVVITSEYIFATDVDSDNLKLMFVIAREPQHGVVRRAGVTVDQFSQRDVISEAVTYKHTGGEIGLMPCFDTITLVVSDGEAGPFVNGCCYNGPNPSVPLHASFPVYDLNITVYPVDNQPPSIAIGPVFVVDEGCSTALTVNHLSATDPDTAADDLEFVLVSPPQFGYLENILPSVGFEKSNIGISIDSFQWKDMNAFHINYVQSRHLRIEPTADQFTVYVTDGKHHSLEIPFSIIINPTNDEAPDFVVQNITVCEGQMKELDSSIISAVDLDIPQDALLFSITQKPRHGLLIDRGFSKDFSENKQPANPHQKHAPVHSFSMELLKTGMRLTYMHDDSESLADDFTIQLSDGKHKILKTISVEVIPVNDEKPMLSKKAEIAMNMGETRIISSAILSAIDEDSPREKIYYVFERLPQNGQLQLKIGRDWVPLSPGMKCTQEEVDLNLLRYTHTGAMDSQNQDSFTFYLWDGNNRSPALDCQITIKDMEKGDIVILTKPLVVSKGDRGFLTTTTLLAVDGTDKPEELLYVITSPPRYGQIEYVHYPGVPITNFSQMDVVGQTVCYVHKSKVTVSSDRFRFIISNGLRTEHGVFEITLETVDRALPVVTRNKGLRLAQGAVGLLSPDLLQLTDPDTPAENLTFLLVQLPQHGQLYLWGTGLLQHNFTQQDVDSKNVAYRHSGGDSQTDCFTFMATDGTNQGFIVNGRVWEEPVLFTIQVDQLDKTAPRITLLHSPSQVGLLKNGCYGIYITSRVLKASDPDTEDDQIIFKILQGPKHGHLENTTTGEFIHEKFSQKDLNSKTILYIINPSLEVNSDTVEFQIMDPTGNSATPQILELKWSHIEWSQTEYEVCENVGLLPLEIIRRGYSMDSAFVGIKVNQVSAAVGKDFTVIPSKLIQFDPGMSTKMWNIAITYDGLEEDDEVFEVILNSPVNAVLGTKTKAAVKILDSKGGQCHPSYSSNQSKHSTWEKGIWHLLPPGSSSSTTSGSFHLERRPLPSSMQLAVIRGDTLRGFDSTDLSQRKLRTRGNGKTVRPSSVYRNGTDIIYNYHGIVSLKLEDDSFPTHKRKAKVSIISQPQKTIKVAELPQADKVESTTDSHFPRQDQLPSFPKNCTLELKGLFHFEEGIQKLYQCNGIAWKAWSPQTKDVEDKSCPAGWHQHSGYCHILITEQKGTWNAAAQACREQYLGNLVTVFSRQHMRWLWDIGGRKSFWIGLNDQVHAGHWEWIGGEPVAFTNGRRGPSQRSKLGKSCVLVQRQGKWQTKDCRRAKPHNYVCSRKL
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.57, 2.03] ÅDownload
The location of the lectin domain structural model is: 2045-2177
We infer [1.57, 2.03] Å as the interval of error of this structural model.
Template 1: 4MTH chain: A, Q06141, NP_002571.1, sequence identity: 27.1%, coverage: 91.7%, location in sequence: 40-175, (40-175 in PDB).
Template 2: 6PWS chain: A, E1BIQ4, XP_005198961.1, sequence identity: 26.3%, coverage: 94.0%, location in sequence: 174-302, (162-290 in PDB).
Template 3: 3L9J chain: C, P05452, NP_003269.2, sequence identity: 25.6%, coverage: 94.0%, location in sequence: 67-201, (46-180 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Elevated expression of FREM1 in breast cancer indicates favorable prognosis and high-level immune infiltration status. [33058542]
  • Bifid nose as the sole manifestation of BNAR syndrome, a FREM1-related condition. [32926405]
  • Toll-like Interleukin 1 Receptor Regulator Is an Important Modulator of Inflammation Responsive Genes. [30873160]
  • A homozygous mutation p.Arg2167Trp in FREM2 causes isolated cryptophthalmos. [29688405]
  • Genome-wide association study of facial morphology reveals novel associations with FREM1 and PARK2. [28441456]
  • TILRR, a novel IL-1RI co-receptor, potentiates MyD88 recruitment to control Ras-dependent amplification of NF-kappaB. [19940113]
  • FREM1 mutations cause bifid nose, renal agenesis, and anorectal malformations syndrome. [19732862]
  • Identification of a novel cell-adhesive protein spatiotemporally expressed in the basement membrane of mouse developing hair follicle. [15878328]
  • The extracellular matrix gene Frem1 is essential for the normal adhesion of the embryonic epidermis. [15345741]
  • Manitoba Oculotrichoanal Syndrome [20301721]
UniProt Main References (7 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The full-ORF clone resource of the German cDNA Consortium. [17974005]
  • DNA sequence and analysis of human chromosome 9. [15164053]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Manitoba-oculo-tricho-anal (MOTA) syndrome is caused by mutations in FREM1. [21507892]
  • Heterozygous mutations of FREM1 are associated with an increased risk of isolated metopic craniosynostosis in humans and mice. [21931569]
  • Novel FREM1 mutations in a patient with MOTA syndrome: Clinical findings, mutation update and review of FREM1-related disorders literature. [28111185]
All isoforms of this gene containing a lectin domain
NP_001171175.1, NP_001356990.1, XP_005251441.1, XP_006716792.1, XP_011516060.1, XP_016869816.1, XP_016869815.1, XP_016869813.1, NP_001366010.1, NP_659403.4, XP_016869805.1, XP_016869806.1, XP_016869808.1, XP_016869809.1, XP_016869810.1, XP_016869811.1, XP_016869812.1
RNA
RNA (Transcript ID: NM_144966.7)
FRAS1 related extracellular matrix 1, transcript variant 1
m7G-5')ppp(5'-ACACAAAAAGCCUUACAAAUGGAAGAACUAAGGUGGUACUUAAAAACAGCACCUUAGGAUCUAGUUCCAUCCUAUCUUUUCCCUUAAAUGCCAUGACAAAAGUUAAAACGGGCCCUGUCCCUUCUGAAUGCUGGGCUUCUCAUCUAAAUUUAAAUAAAAACCUUUGAAGAUGGGAAUGUGUUGGAAGAAAAGAAGGGCAGAAAAAAAGUGUGUUGGAAGAGUCUGUGGAGUCCUGAGGCUUGGCGCUCAGGAAGUUUGCAAAGCUGCAGCAGCUGCCUUGGAGAAGACCAGCAAAGAAAGUGGAGUGUGUAUGUGAACUUCAAUUCUGUAUUUUCUGUGAGGUGGGUUAAUGGAUUUUUAGUAAAAAGAAAUCUCAAACACAGCUGACCUGAAAGACUGGAAUUUCAGCUCUCUUCCUUCCCGGGGUUCUUUUUCCUCCCCCUUCCUCUCAAAGCCCUUUAAACCAGAUUGCUGUGUCAGUGACUCUUAUCCUGCCCGCCAGUUCCAAGGGUUUCUAACUUUUUGUCUUGGAAAGGAAAACCACUACCUGAUUAGAAAAGCACUUGGGAAGCCCAUUAAUCUUGCCGGCGUUGUCAGGAGUGAUCAGCGAGUUUUAUUAAAAGCCCUGGGAUUGCCUGAAAGGCCCCCUUGUCUGACUUUGAAAUGAAAGGGGCAUGUUAAGAUCUCGGGGCACAUUGUCAGGACCCCUCACCCUGCCCCUUGGACUAUGAGCUGACCCUCCAGGAGGAAGCACAGAAGCCCUCCUUUGUUAAAGGGAUUUCGCCGGUGGACAGAGAAGAGUUGGGCCCUGUCAGCAUGAACUCUCUGAGUUGGGGGGCUGCGAAUGCCGUGCUGCUGCUGCUCCUCCUGGCCUGGGCCAGCCCCACCUUCAUCAGCAUCAACCGCGGGGUGAGGGUGAUGAAGGGCCACUCUGCCUUCCUGUCAGGAGAUGACCUGAAGUUUGCCAUCCCUAAAGAGAAAGAUGCCUGCAAAGUGGAAGUUGUGAUGAAUGAGCCAAUAACCCAGAGGGUUGGGAAACUCACUCCACAGGUCUUUGACUGCCAUUUCCUUCCCAACGAAGUCAAGUAUGUUCACAAUGGUUGUCCAAUUCUUGAUGAAGACACAGUGAAGCUCAGACUUUACAGAUUUACUGAAAGAGAUACCUUCAUAGAAACUUUUAUCCUGUGGGUCUAUCUCCUGGAACCAGACUGUAACAUCAUCCAUAUGAGUAACAAUGUGCUGGAGGUGCCUGAAUUCAAUGGCUUGUCCCAAGCGAUUGAUAAAAAUCUGCUCAGAUUCGAUUAUGAUAGGAUGGCUAGCCUGGAAUGUACCGUCAGCCUGGACACUGCGAGAACUCGGCUGCCAGCCCAUGGCCAGAUGGUUCUCGGGGAGCCUCGACCAGAAGAACCUCGUGGAGAUCAGCCACACAGUUUUUUCCCAGAGUCCCAACUGAGAGCAAAACUGAAGUGUCCAGGUGGGAGCUGUACCCCAGGAUUAAAGAAAAUAGGAAGCCUCAAAGUGAGCUGUGAGGAGUUCCUGCUGAUGGGCCUUCGUUAUCAGCAUCUGGAUCCCCCUUCACCCAACAUUGAUUAUAUCUCCAUCCAACUGGACCUCACAGAUACCAGGAGCAAAAUUGUGUACAAGUCAGAGAGUGCGUGGCUGCCUGUCUAUAUCAGAGCUGGAAUUCCGAAUCAGAUUCCAAAGGCUGCAUUCAUGGCCGUGUUUAUUCUGGAAGUGGAUCAGUUCAUCCUGACCUCCUUGACUACAUCAGUUCUGGACUGUGAAGAAGAUGAGACCCCUAAACCCUUGCUGGUGUUCAACAUUACUAAAGCCCCGCUCCAGGGCUAUGUGACUCACCUGUUGGAUCACACCAGACCAAUCUCCUCAUUCACCUGGAAAGAUCUCAGUGACAUGCAGAUCGCCUAUCAGCCACCAAACAGCAGCCAUUCUGAGAGGAGACAUGAUGAGGUAGAAUUGGAGGUAUACGACUUCUUCUUUGAAAGGAGUGCACCUAUGACAGUCCACAUCUCCAUCAGAACAGCAGAUACAAAUGCCCCCCGUGUAUCCUGGAAUACAGGUCUGAGUCUCCUUGAGGGGCAGUCUCGAGCCAUCACUUGGGAACAGUUUCAGGUUGUCGACAAUGACGACAUUGGUGCUGUCCGGCUAGUCACCGUUGGUGGCCUGCAGCAUGGAUGGCUGACUUUAAGAGGGGGGAAAGGGUUUCUCUUCACCGUGGCUGACCUCCAGGCUGGAGUUGUUCGCUAUCAUCAUGAUGACAGCGACUCCACCAAAGACUUCGUGGUCUUCCGGAUAUUUGAUGGCCAUCACAGCAUCCGUCACAAAUUCCCCAUCAACGUCUUGCCCAAAGAUGAUAGUCCCCCGUUCCUCAUAACCAAUGUUGUGAUUGAACUGGAGGAGGGGCAGACCAUCCUGAUCCAGGGAUCCAUGCUGCGAGCUUCAGAUGUGGACGCCAGUGAUGACUACAUCUUCUUCAAUAUCACAAAGCCUCCACAGGCUGGGGAGAUCAUGAAGAAGCCAGGGCCAGGACUGAUAGGCUAUCCUGUCCAUGGCUUCCUUCAGAGGGAUUUGUUUAAUGGAAUCAUUUAUUAUCGUCAUUUUGGUGGAGAAAUCUUUGAAGAUUCUUUUCAAUUUGUCCUGUGGGACAGCCAUGAACCUCCAAAUCUUUCAGUGCCACAGGUGGCAACAAUCCAUAUAACUCCAGUGGAUGACCAGCUUCCAAAAGAGGCUCCUGGAGUUUCUCGGCAUUUGGUUGUCAAGGAAACUGAGGUGGCCUAUAUAACUAAGAAACAGCUACAUUUUAUAGAUUCAGAAUCAUAUGACAGGGAGCUGGUCUACACAAUAACUACUCCUCCAUUUUUCUCCUUCAGCCACAGACACUUGGAUGCUGGGAAAUUAUUUAUGGUGGACAGCAUACCAAAAGUAGUUAAGAAUCCUACGGCCCUGGAGCUGAGGUCAUUCACUCAGCAUGCUGUGAACUAUAUGAAAGUGGCCUACAUGCCCCCCAUGCAAGACAUUGGUCCCCAUUGCAGAGAUGUCCAGUUCACAUUUUCUGUCAGUAACCAACAUGGCGGUACUUUGCAUGGGAUCUGCUUUAACAUUACAAUCCUCCCAGUGGACAAUCAAGUUCCUGAGGCGUUCACCAACCCUCUGAAAGUGACUGAGGGAGGUCAAAGCAUCAUCAGCACAGAGCACAUUCUAAUUUCUGAUGCAGAUACCAAGCUGGACAAUAUUGACCUCUCCCUGCGGGAAUUGCCUCUGCACGGAAGGGUGGAGCUGAAUGGAUUUCCUCUAAAUUCAGGGGGCACAUUUUCUUGGGGCGAUCUCCAUACCUUAAAAGUUAGGUAUCAACAUGAUGGAACUGAAGUUCUUCAGGAUGACCUACUCUUGGAGGUCACCGAUGGCACAAAUUCAGCAGAAUUUGUACUACAUGUUGAGGUAUUCCCUGUCAACGAUGAGCCACCAGUCUUAAAGGCUGACCUCAUGCCUGUCAUGAAUUGCUCAGAGGGAGGAGAGGUGGUCAUCACCUCUGAAUACAUUUUUGCUACUGAUGUGGACAGCGAUAACUUGAAGUUGAUGUUUGUGAUUGCUCGCGAACCUCAGCAUGGGGUGGUGAGGAGAGCUGGAGUCACAGUGGAUCAGUUCUCUCAGAGAGAUGUUAUCUCAGAGGCCGUGACAUACAAACACACAGGUGGCGAGAUUGGCCUGAUGCCUUGUUUUGACACCAUUACAUUGGUGGUUUCGGAUGGAGAGGCUGGCCCUUUUGUGAAUGGCUGUUGCUACAAUGGACCCAAUCCAUCUGUUCCACUUCAUGCGUCCUUUCCAGUGUAUGAUCUCAACAUCACGGUAUACCCAGUAGACAACCAGCCACCUUCCAUUGCAAUAGGUCCCGUGUUUGUUGUAGAUGAGGGCUGCUCAACAGCCCUUACUGUUAACCAUUUGUCCGCCACUGACCCUGACACUGCAGCAGAUGACUUGGAAUUUGUUUUGGUUUCUCCUCCUCAGUUUGGCUACCUCGAAAAUAUACUCCCUUCUGUGGGUUUUGAAAAAAGCAAUAUUGGCAUAAGUAUAGAUUCAUUUCAGUGGAAAGACAUGAACGCUUUUCACAUUAACUAUGUGCAGUCCAGGCAUCUGAGGAUAGAACCAACUGCCGACCAGUUCACGGUGUACGUCACAGAUGGGAAGCAUCACUCCUUGGAGAUACCAUUUUCUAUUAUAAUCAACCCCACAAAUGAUGAAGCUCCUGACUUUGUAGUGCAGAAUAUUACUGUGUGUGAGGGUCAGAUGAAAGAGCUGGACUCUUCCAUCAUCAGCGCUGUGGACCUGGACAUUCCCCAGGAUGCCCUGCUGUUCAGCAUCACUCAAAAGCCACGCCAUGGCCUCCUCAUCGAUAGGGGGUUUAGCAAAGACUUCUCUGAGAAUAAGCAGCCAGCCAACCCUCACCAGAAACAUGCACCUGUUCACAGCUUUUCCAUGGAACUCCUCAAGACUGGAAUGAGGUUGACGUACAUGCAUGAUGACUCAGAGAGCCUUGCUGAUGAUUUUACAAUCCAAUUGUCAGAUGGGAAACAUAAGAUACUUAAAACCAUUUCAGUAGAGGUCAUCCCAGUUAAUGAUGAAAAACCAAUGCUGAGCAAGAAGGCUGAAAUUGCAAUGAAUAUGGGUGAAACUCGUAUUAUUUCCAGUGCUAUUCUUUCAGCCAUAGAUGAAGACUCACCCAGGGAGAAGAUUUACUAUGUAUUUGAAAGGCUUCCCCAAAAUGGGCAACUUCAGCUUAAGAUAGGGAGGGACUGGGUUCCUCUCUCCCCUGGCAUGAAAUGCACUCAGGAGGAAGUGGAUCUGAACUUGCUGAGAUACACACACACCGGGGCAAUGGAUUCCCAGAAUCAAGAUAGCUUCACCUUCUACCUUUGGGAUGGCAACAACAGGUCCCCUGCUCUUGACUGUCAAAUCACCAUCAAGGACAUGGAAAAAGGUGAUAUUGUCAUCCUUACAAAACCACUCGUGGUGUCUAAAGGUGAUAGAGGUUUCUUAACAACCACCACGCUCCUGGCUGUGGACGGAACAGACAAGCCUGAGGAACUGCUCUAUGUCAUCACCUCCCCUCCGCGAUAUGGCCAGAUCGAAUAUGUUCACUAUCCUGGAGUUCCCAUUACAAACUUCAGCCAAAUGGAUGUAGUGGGGCAGACAGUUUGCUAUGUACACAAGAGCAAGGUGACUGUCUCCAGUGACAGAUUCAGAUUCAUCAUCAGCAAUGGACUGCGGACCGAGCACGGGGUGUUUGAGAUCACACUGGAGACUGUGGACAGAGCCCUGCCUGUGGUAACCAGGAACAAGGGGUUGAGACUGGCCCAAGGGGCCGUGGGCCUGCUUUCCCCUGACCUCCUUCAGCUGACCGACCCUGAUACACCUGCGGAGAACCUCACCUUCCUCUUGGUUCAGCUCCCCCAGCAUGGCCAGCUCUACCUGUGGGGGACAGGGCUACUUCAACACAAUUUCACCCAGCAGGAUGUGGACAGCAAGAAUGUGGCCUAUCGGCACUCAGGAGGGGACUCCCAGACUGACUGCUUUACUUUCAUGGCCACAGAUGGGACAAACCAAGGCUUUAUUGUGAAUGGGAGAGUGUGGGAAGAACCUGUUUUAUUCACCAUUCAGGUAGACCAAUUGGACAAAACAGCUCCUCGUAUCACACUCUUGCAUUCCCCUUCUCAAGUGGGGCUCCUGAAAAAUGGCUGCUACGGGAUUUACAUCACUUCCCGCGUGUUGAAGGCAUCAGACCCUGACACUGAGGACGAUCAGAUCAUCUUUAAAAUUCUACAAGGCCCAAAACAUGGACAUCUGGAGAACACAACAACAGGUGAAUUUAUCCAUGAGAAAUUUAGCCAAAAGGACUUAAACAGUAAGACUAUUCUUUACAUCAUAAACCCAUCUUUGGAAGUAAAUUCAGAUACCGUGGAAUUUCAAAUCAUGGACCCCACAGGGAACUCGGCCACUCCUCAAAUUUUGGAACUGAAGUGGUCUCAUAUUGAAUGGUCACAGACCGAAUAUGAAGUCUGUGAGAAUGUGGGUUUGUUGCCCUUGGAAAUUAUCAGAAGGGGAUAUUCCAUGGACUCGGCCUUUGUGGGUAUAAAGGUCAACCAAGUGUCAGCUGCAGUUGGAAAAGAUUUCACCGUGAUUCCAUCUAAACUGAUUCAGUUUGACCCAGGAAUGUCAACUAAGAUGUGGAAUAUAGCAAUUACCUAUGACGGAUUAGAGGAAGAUGAUGAGGUCUUUGAAGUAAUUCUGAACUCCCCUGUGAAUGCAGUUCUUGGCACAAAGACAAAAGCUGCAGUGAAAAUUUUGGACUCAAAAGGAGGACAAUGCCAUCCUUCAUAUUCCUCCAACCAAAGCAAGCACAGCACAUGGGAGAAGGGCAUUUGGCAUCUGCUGCCCCCAGGGUCUUCCUCAUCCACCACUUCUGGUUCCUUUCAUCUGGAAAGAAGACCUCUUCCAUCUUCCAUGCAGCUAGCAGUCAUCAGGGGAGACACCCUGCGGGGCUUUGAUUCUACAGAUCUUUCUCAAAGGAAGCUUAGGACCCGUGGGAAUGGCAAAACAGUUCGUCCAUCCUCUGUUUAUAGAAAUGGAACAGACAUCAUCUAUAAUUAUCAUGGGAUAGUUUCCUUGAAACUGGAGGAUGACAGUUUCCCAACUCACAAAAGGAAGGCCAAAGUAUCCAUCAUUAGUCAGCCACAAAAGACAAUCAAAGUGGCAGAACUGCCUCAAGCAGAUAAGGUGGAAUCCACAACUGACUCACACUUCCCCAGACAGGACCAGUUGCCCUCAUUUCCAAAGAACUGCACUCUGGAAUUAAAGGGACUCUUCCAUUUUGAAGAAGGCAUCCAGAAGCUGUAUCAGUGCAAUGGGAUCGCCUGGAAAGCCUGGAGUCCCCAAACCAAGGAUGUGGAAGACAAAUCCUGUCCAGCCGGGUGGCACCAGCACUCAGGCUACUGUCACAUCUUGAUCACAGAGCAGAAAGGCACCUGGAAUGCGGCUGCCCAAGCUUGCAGGGAACAAUACCUGGGCAACCUUGUAACUGUAUUCUCCAGGCAGCACAUGCGGUGGCUCUGGGACAUUGGUGGGAGAAAGUCCUUUUGGAUAGGUUUGAACGACCAAGUGCAUGCUGGCCACUGGGAGUGGAUCGGUGGUGAACCUGUUGCCUUCACCAAUGGGAGAAGAGGGCCCUCUCAACGCUCCAAGCUUGGAAAGAGCUGUGUUUUGGUUCAAAGACAAGGGAAAUGGCAAACAAAAGACUGUAGGAGAGCCAAACCUCAUAAUUAUGUGUGUUCCAGAAAACUCUAAAUAUAACAGACCCUACAGGGGGCCACCUGGAGUUUGUCACCUAUUUAUUCACAGGAUCUGUGAAUAUUGCUCCAUAGAAAACAAAUUGUUAUGAUUGAGUGGGUAUACCUUUGUGAUUCUGUCUAGUGAAAAUGGGACAUUUUUAAUAGUGCCAGAAAGAUUGAUAAAUAAAUAUUUUUUACAAGAUAAGAUACAAUUUUUGUAUCUCAAUACCUUUUAAAAUAAAUGCCAGCAGUAUUAUAAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 158326)
FRAS1 related extracellular matrix 1
strand -
FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR
NCBI CDS gene sequence (6540 bp)
5'-ATGAACTCTCTGAGTTGGGGGGCTGCGAATGCCGTGCTGCTGCTGCTCCTCCTGGCCTGGGCCAGCCCCACCTTCATCAGCATCAACCGCGGGGTGAGGGTGATGAAGGGCCACTCTGCCTTCCTGTCAGGAGATGACCTGAAGTTTGCCATCCCTAAAGAGAAAGATGCCTGCAAAGTGGAAGTTGTGATGAATGAGCCAATAACCCAGAGGGTTGGGAAACTCACTCCACAGGTCTTTGACTGCCATTTCCTTCCCAACGAAGTCAAGTATGTTCACAATGGTTGTCCAATTCTTGATGAAGACACAGTGAAGCTCAGACTTTACAGATTTACTGAAAGAGATACCTTCATAGAAACTTTTATCCTGTGGGTCTATCTCCTGGAACCAGACTGTAACATCATCCATATGAGTAACAATGTGCTGGAGGTGCCTGAATTCAATGGCTTGTCCCAAGCGATTGATAAAAATCTGCTCAGATTCGATTATGATAGGATGGCTAGCCTGGAATGTACCGTCAGCCTGGACACTGCGAGAACTCGGCTGCCAGCCCATGGCCAGATGGTTCTCGGGGAGCCTCGACCAGAAGAACCTCGTGGAGATCAGCCACACAGTTTTTTCCCAGAGTCCCAACTGAGAGCAAAACTGAAGTGTCCAGGTGGGAGCTGTACCCCAGGATTAAAGAAAATAGGAAGCCTCAAAGTGAGCTGTGAGGAGTTCCTGCTGATGGGCCTTCGTTATCAGCATCTGGATCCCCCTTCACCCAACATTGATTATATCTCCATCCAACTGGACCTCACAGATACCAGGAGCAAAATTGTGTACAAGTCAGAGAGTGCGTGGCTGCCTGTCTATATCAGAGCTGGAATTCCGAATCAGATTCCAAAGGCTGCATTCATGGCCGTGTTTATTCTGGAAGTGGATCAGTTCATCCTGACCTCCTTGACTACATCAGTTCTGGACTGTGAAGAAGATGAGACCCCTAAACCCTTGCTGGTGTTCAACATTACTAAAGCCCCGCTCCAGGGCTATGTGACTCACCTGTTGGATCACACCAGACCAATCTCCTCATTCACCTGGAAAGATCTCAGTGACATGCAGATCGCCTATCAGCCACCAAACAGCAGCCATTCTGAGAGGAGACATGATGAGGTAGAATTGGAGGTATACGACTTCTTCTTTGAAAGGAGTGCACCTATGACAGTCCACATCTCCATCAGAACAGCAGATACAAATGCCCCCCGTGTATCCTGGAATACAGGTCTGAGTCTCCTTGAGGGGCAGTCTCGAGCCATCACTTGGGAACAGTTTCAGGTTGTCGACAATGACGACATTGGTGCTGTCCGGCTAGTCACCGTTGGTGGCCTGCAGCATGGATGGCTGACTTTAAGAGGGGGGAAAGGGTTTCTCTTCACCGTGGCTGACCTCCAGGCTGGAGTTGTTCGCTATCATCATGATGACAGCGACTCCACCAAAGACTTCGTGGTCTTCCGGATATTTGATGGCCATCACAGCATCCGTCACAAATTCCCCATCAACGTCTTGCCCAAAGATGATAGTCCCCCGTTCCTCATAACCAATGTTGTGATTGAACTGGAGGAGGGGCAGACCATCCTGATCCAGGGATCCATGCTGCGAGCTTCAGATGTGGACGCCAGTGATGACTACATCTTCTTCAATATCACAAAGCCTCCACAGGCTGGGGAGATCATGAAGAAGCCAGGGCCAGGACTGATAGGCTATCCTGTCCATGGCTTCCTTCAGAGGGATTTGTTTAATGGAATCATTTATTATCGTCATTTTGGTGGAGAAATCTTTGAAGATTCTTTTCAATTTGTCCTGTGGGACAGCCATGAACCTCCAAATCTTTCAGTGCCACAGGTGGCAACAATCCATATAACTCCAGTGGATGACCAGCTTCCAAAAGAGGCTCCTGGAGTTTCTCGGCATTTGGTTGTCAAGGAAACTGAGGTGGCCTATATAACTAAGAAACAGCTACATTTTATAGATTCAGAATCATATGACAGGGAGCTGGTCTACACAATAACTACTCCTCCATTTTTCTCCTTCAGCCACAGACACTTGGATGCTGGGAAATTATTTATGGTGGACAGCATACCAAAAGTAGTTAAGAATCCTACGGCCCTGGAGCTGAGGTCATTCACTCAGCATGCTGTGAACTATATGAAAGTGGCCTACATGCCCCCCATGCAAGACATTGGTCCCCATTGCAGAGATGTCCAGTTCACATTTTCTGTCAGTAACCAACATGGCGGTACTTTGCATGGGATCTGCTTTAACATTACAATCCTCCCAGTGGACAATCAAGTTCCTGAGGCGTTCACCAACCCTCTGAAAGTGACTGAGGGAGGTCAAAGCATCATCAGCACAGAGCACATTCTAATTTCTGATGCAGATACCAAGCTGGACAATATTGACCTCTCCCTGCGGGAATTGCCTCTGCACGGAAGGGTGGAGCTGAATGGATTTCCTCTAAATTCAGGGGGCACATTTTCTTGGGGCGATCTCCATACCTTAAAAGTTAGGTATCAACATGATGGAACTGAAGTTCTTCAGGATGACCTACTCTTGGAGGTCACCGATGGCACAAATTCAGCAGAATTTGTACTACATGTTGAGGTATTCCCTGTCAACGATGAGCCACCAGTCTTAAAGGCTGACCTCATGCCTGTCATGAATTGCTCAGAGGGAGGAGAGGTGGTCATCACCTCTGAATACATTTTTGCTACTGATGTGGACAGCGATAACTTGAAGTTGATGTTTGTGATTGCTCGCGAACCTCAGCATGGGGTGGTGAGGAGAGCTGGAGTCACAGTGGATCAGTTCTCTCAGAGAGATGTTATCTCAGAGGCCGTGACATACAAACACACAGGTGGCGAGATTGGCCTGATGCCTTGTTTTGACACCATTACATTGGTGGTTTCGGATGGAGAGGCTGGCCCTTTTGTGAATGGCTGTTGCTACAATGGACCCAATCCATCTGTTCCACTTCATGCGTCCTTTCCAGTGTATGATCTCAACATCACGGTATACCCAGTAGACAACCAGCCACCTTCCATTGCAATAGGTCCCGTGTTTGTTGTAGATGAGGGCTGCTCAACAGCCCTTACTGTTAACCATTTGTCCGCCACTGACCCTGACACTGCAGCAGATGACTTGGAATTTGTTTTGGTTTCTCCTCCTCAGTTTGGCTACCTCGAAAATATACTCCCTTCTGTGGGTTTTGAAAAAAGCAATATTGGCATAAGTATAGATTCATTTCAGTGGAAAGACATGAACGCTTTTCACATTAACTATGTGCAGTCCAGGCATCTGAGGATAGAACCAACTGCCGACCAGTTCACGGTGTACGTCACAGATGGGAAGCATCACTCCTTGGAGATACCATTTTCTATTATAATCAACCCCACAAATGATGAAGCTCCTGACTTTGTAGTGCAGAATATTACTGTGTGTGAGGGTCAGATGAAAGAGCTGGACTCTTCCATCATCAGCGCTGTGGACCTGGACATTCCCCAGGATGCCCTGCTGTTCAGCATCACTCAAAAGCCACGCCATGGCCTCCTCATCGATAGGGGGTTTAGCAAAGACTTCTCTGAGAATAAGCAGCCAGCCAACCCTCACCAGAAACATGCACCTGTTCACAGCTTTTCCATGGAACTCCTCAAGACTGGAATGAGGTTGACGTACATGCATGATGACTCAGAGAGCCTTGCTGATGATTTTACAATCCAATTGTCAGATGGGAAACATAAGATACTTAAAACCATTTCAGTAGAGGTCATCCCAGTTAATGATGAAAAACCAATGCTGAGCAAGAAGGCTGAAATTGCAATGAATATGGGTGAAACTCGTATTATTTCCAGTGCTATTCTTTCAGCCATAGATGAAGACTCACCCAGGGAGAAGATTTACTATGTATTTGAAAGGCTTCCCCAAAATGGGCAACTTCAGCTTAAGATAGGGAGGGACTGGGTTCCTCTCTCCCCTGGCATGAAATGCACTCAGGAGGAAGTGGATCTGAACTTGCTGAGATACACACACACCGGGGCAATGGATTCCCAGAATCAAGATAGCTTCACCTTCTACCTTTGGGATGGCAACAACAGGTCCCCTGCTCTTGACTGTCAAATCACCATCAAGGACATGGAAAAAGGTGATATTGTCATCCTTACAAAACCACTCGTGGTGTCTAAAGGTGATAGAGGTTTCTTAACAACCACCACGCTCCTGGCTGTGGACGGAACAGACAAGCCTGAGGAACTGCTCTATGTCATCACCTCCCCTCCGCGATATGGCCAGATCGAATATGTTCACTATCCTGGAGTTCCCATTACAAACTTCAGCCAAATGGATGTAGTGGGGCAGACAGTTTGCTATGTACACAAGAGCAAGGTGACTGTCTCCAGTGACAGATTCAGATTCATCATCAGCAATGGACTGCGGACCGAGCACGGGGTGTTTGAGATCACACTGGAGACTGTGGACAGAGCCCTGCCTGTGGTAACCAGGAACAAGGGGTTGAGACTGGCCCAAGGGGCCGTGGGCCTGCTTTCCCCTGACCTCCTTCAGCTGACCGACCCTGATACACCTGCGGAGAACCTCACCTTCCTCTTGGTTCAGCTCCCCCAGCATGGCCAGCTCTACCTGTGGGGGACAGGGCTACTTCAACACAATTTCACCCAGCAGGATGTGGACAGCAAGAATGTGGCCTATCGGCACTCAGGAGGGGACTCCCAGACTGACTGCTTTACTTTCATGGCCACAGATGGGACAAACCAAGGCTTTATTGTGAATGGGAGAGTGTGGGAAGAACCTGTTTTATTCACCATTCAGGTAGACCAATTGGACAAAACAGCTCCTCGTATCACACTCTTGCATTCCCCTTCTCAAGTGGGGCTCCTGAAAAATGGCTGCTACGGGATTTACATCACTTCCCGCGTGTTGAAGGCATCAGACCCTGACACTGAGGACGATCAGATCATCTTTAAAATTCTACAAGGCCCAAAACATGGACATCTGGAGAACACAACAACAGGTGAATTTATCCATGAGAAATTTAGCCAAAAGGACTTAAACAGTAAGACTATTCTTTACATCATAAACCCATCTTTGGAAGTAAATTCAGATACCGTGGAATTTCAAATCATGGACCCCACAGGGAACTCGGCCACTCCTCAAATTTTGGAACTGAAGTGGTCTCATATTGAATGGTCACAGACCGAATATGAAGTCTGTGAGAATGTGGGTTTGTTGCCCTTGGAAATTATCAGAAGGGGATATTCCATGGACTCGGCCTTTGTGGGTATAAAGGTCAACCAAGTGTCAGCTGCAGTTGGAAAAGATTTCACCGTGATTCCATCTAAACTGATTCAGTTTGACCCAGGAATGTCAACTAAGATGTGGAATATAGCAATTACCTATGACGGATTAGAGGAAGATGATGAGGTCTTTGAAGTAATTCTGAACTCCCCTGTGAATGCAGTTCTTGGCACAAAGACAAAAGCTGCAGTGAAAATTTTGGACTCAAAAGGAGGACAATGCCATCCTTCATATTCCTCCAACCAAAGCAAGCACAGCACATGGGAGAAGGGCATTTGGCATCTGCTGCCCCCAGGGTCTTCCTCATCCACCACTTCTGGTTCCTTTCATCTGGAAAGAAGACCTCTTCCATCTTCCATGCAGCTAGCAGTCATCAGGGGAGACACCCTGCGGGGCTTTGATTCTACAGATCTTTCTCAAAGGAAGCTTAGGACCCGTGGGAATGGCAAAACAGTTCGTCCATCCTCTGTTTATAGAAATGGAACAGACATCATCTATAATTATCATGGGATAGTTTCCTTGAAACTGGAGGATGACAGTTTCCCAACTCACAAAAGGAAGGCCAAAGTATCCATCATTAGTCAGCCACAAAAGACAATCAAAGTGGCAGAACTGCCTCAAGCAGATAAGGTGGAATCCACAACTGACTCACACTTCCCCAGACAGGACCAGTTGCCCTCATTTCCAAAGAACTGCACTCTGGAATTAAAGGGACTCTTCCATTTTGAAGAAGGCATCCAGAAGCTGTATCAGTGCAATGGGATCGCCTGGAAAGCCTGGAGTCCCCAAACCAAGGATGTGGAAGACAAATCCTGTCCAGCCGGGTGGCACCAGCACTCAGGCTACTGTCACATCTTGATCACAGAGCAGAAAGGCACCTGGAATGCGGCTGCCCAAGCTTGCAGGGAACAATACCTGGGCAACCTTGTAACTGTATTCTCCAGGCAGCACATGCGGTGGCTCTGGGACATTGGTGGGAGAAAGTCCTTTTGGATAGGTTTGAACGACCAAGTGCATGCTGGCCACTGGGAGTGGATCGGTGGTGAACCTGTTGCCTTCACCAATGGGAGAAGAGGGCCCTCTCAACGCTCCAAGCTTGGAAAGAGCTGTGTTTTGGTTCAAAGACAAGGGAAATGGCAAACAAAAGACTGTAGGAGAGCCAAACCTCATAATTATGTGTGTTCCAGAAAACTCTAA-3'
NCBI CDS gene sequence with introns (location: 14737396.. 14868977) (131582 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 14737152.. 14910995) (173844 bp)Download
NCBI gene sequence (location: [14737152.. 14910995 + 1000]) (174844 bp)Download
Cite How to cite