NCBI Summary
This gene encodes both membrane-bound and secreted protein isoforms. A membrane-bound isoform exhibits sequence similarity with the mouse mahogany protein, a receptor involved in controlling obesity. A secreted isoform is involved in the initial immune cell clustering during inflammatory responses that may regulate the chemotactic activity of chemokines. [provided by RefSeq, Apr 2016].
Protein
Protein (NP_647537)
Attractin
Attractin (DPPT-L) (Mahogany homolog)
ATRN
attractin
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Attractin
a/b mixed / C-type lectin-like
Uncharacterised
0.371
Undefined
Protein sequence and protein families (fasta) (1429 amino acids) Download
MVAAAAATEARLRRRTAATAALAGRSGGPHWDWDVTRAGRPGLGAGLRLPRLLSPPLRPRLLLLLLLLSPPLLLLLLPCEAEAAAAAAAVSGSAAAEAKECDRPCVNGGRCNPGTGQCVCPAGWVGEQCQHCGGRFRLTGSSGFVTDGPGNYKYKTKCTWLIEGQPNRIMRLRFNHFATECSWDHLYVYDGDSIYAPLVAAFSGLIVPERDGNETVPEVVATSGYALLHFFSDAAYNLTGFNITYSFDMCPNNCSGRGECKISNSSDTVECECSENWKGEACDIPHCTDNCGFPHRGICNSSDVRGCSCFSDWQGPGCSVPVPANQSFWTREEYSNLKLPRASHKAVVNGNIMWVVGGYMFNHSDYNMVLAYDLASREWLPLNRSVNNVVVRYGHSLALYKDKIYMYGGKIDSTGNVTNELRVFHIHNESWVLLTPKAKEQYAVVGHSAHIVTLKNGRVVMLVIFGHCPLYGYISNVQEYDLDKNTWSILHTQGALVQGGYGHSSVYDHRTRALYVHGGYKAFSANKYRLADDLYRYDVDTQMWTILKDSRFFRYLHTAVIVSGTMLVFGGNTHNDTSMSHGAKCFSSDFMAYDIACDRWSVLPRPDLHHDVNRFGHSAVLHNSTMYVFGGFNSLLLSDILVFTSEQCDAHRSEAACLAAGPGIRCVWNTGSSQCISWALATDEQEEKLKSECFSKRTLDHDRCDQHTDCYSCTANTNDCHWCNDHCVPRNHSCSEGQISIFRYENCPKDNPMYYCNKKTSCRSCALDQNCQWEPRNQECIALPENICGIGWHLVGNSCLKITTAKENYDNAKLFCRNHNALLASLTTQKKVEFVLKQLRIMQSSQSMSKLTLTPWVGLRKINVSYWCWEDMSPFTNSLLQWMPSEPSDAGFCGILSEPSTRGLKAATCINPLNGSVCERPANHSAKQCRTPCALRTACGDCTSGSSECMWCSNMKQCVDSNAYVASFPFGQCMEWYTMSTCPPENCSGYCTCSHCLEQPGCGWCTDPSNTGKGKCIEGSYKGPVKMPSQAPTGNFYPQPLLNSSMCLEDSRYNWSFIHCPACQCNGHSKCINQSICEKCENLTTGKHCETCISGFYGDPTNGGKCQPCKCNGHASLCNTNTGKCFCTTKGVKGDECQLCEVENRYQGNPLRGTCYYTLLIDYQFTFSLSQEDDRYYTAINFVATPDEQNRDLDMFINASKNFNLNITWAASFSAGTQAGEEMPVVSKTNIKEYKDSFSNEKFDFRNHPNITFFVYVSNFTWPIKIQIAFSQHSNFMDLVQFFVTFFSCFLSLLLVAAVVWKIKQSCWASRRREQLLREMQQMASRPFASVNVALETDEEPPDLIGGSIKTVPKPIALEPCFGNKAAVLSVFVRLPRGLGGIPPPGQSGLAVASALVDISQQMPIVYKEKSGAVRNRKQQPPAQPGTCI
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [ err > 2 Å]Download
The location of the lectin domain structural model is: 782-959
We infer [ err > 2 Å] as the interval of error of this structural model.
Template 1: 1G1T chain: A, P16581, NP_000441.2, sequence identity: 18.5%, coverage: 80.3%, location in sequence: 22-176, (1-155 in PDB).
Template 2: 5B1X chain: A, Q9UMR7, NP_057268.1, sequence identity: 19.1%, coverage: 70.2%, location in sequence: 105-234, (105-234 in PDB).
Template 3: 5VC1 chain: A, P14151, NP_000646.3, sequence identity: 19.1%, coverage: 79.2%, location in sequence: 39-191, (1-153 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Hypomyelinating leukodystrophy associated with a deleterious mutation in the ATRN gene. [28493104]
  • Expression of Attractin in male reproductive tract of human and mice and its correlation with male reproduction. [25318887]
  • Dipeptidyl-peptidase 4 and attractin expression is increased in circulating blood monocytes of obese human subjects. [20198559]
  • Novel partners of SPAG11B isoform D in the human male reproductive tract. [19535787]
  • Genetic variants in pigmentation genes, pigmentary phenotypes, and risk of skin cancer in Caucasians. [19384953]
  • The DNA sequence and comparative analysis of human chromosome 20. [11780052]
  • Secreted and membrane attractin result from alternative splicing of the human ATRN gene. [10811918]
  • Attractin (DPPT-L), a member of the CUB family of cell adhesion and guidance proteins, is secreted by activated human T lymphocytes and modulates immune cell interactions. [9736737]
  • Serum high molecular weight dipeptidyl peptidase IV (CD26) is similar to a novel antigen DPPT-L released from activated T cells. [8596018]
  • [Topical timolol and blood-aqueous barrier permeability to protein in human eyes]. [1476071]
UniProt Main References (9 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • A novel form of dipeptidylpeptidase IV found in human serum. Isolation, characterization, and comparison with T lymphocyte membrane dipeptidylpeptidase IV (CD26). [7539799]
  • Prediction of the coding sequences of unidentified human genes. IX. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. [9628581]
  • Does human attractin have DP4 activity? [17261078]
  • Screening for N-glycosylated proteins by liquid chromatography mass spectrometry. [14760718]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
  • Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
  • A strategy for precise and large scale identification of core fucosylated glycoproteins. [19139490]
All isoforms of this gene containing a lectin domain
NP_001193976.1, NP_647537.1, NP_001310261.1, NP_647538.1
RNA
RNA (Transcript ID: NM_139321.3)
attractin, transcript variant 1
m7G-5')ppp(5'-ACAGCCCCGCCCCGCACGGCCAGGCGAAGCGGAGCCGGCCGUGCGGUGUGUGUGUAUGUGUUCGCGGGGCGCCGUCUCAGCCCCGGGAAGAUGGUGGCUGCAGCGGCGGCAACUGAGGCAAGGCUGAGGAGGAGGACGGCGGCGACGGCAGCGCUCGCGGGCAGGAGCGGCGGGCCGCACUGGGACUGGGACGUGACCAGGGCUGGGAGGCCGGGGCUGGGGGCCGGGCUGCGCCUCCCGCGGCUGCUGUCUCCACCGCUGCGGCCACGGCUGCUGCUGCUGCUGUUGUUGCUCUCGCCGCCGCUGCUGCUGCUGCUGCUGCCCUGUGAGGCCGAGGCCGCGGCGGCGGCGGCGGCGGUGUCGGGCUCAGCCGCAGCCGAGGCCAAGGAAUGUGACCGGCCCUGUGUCAACGGCGGUCGCUGCAACCCUGGCACCGGCCAGUGCGUCUGCCCCGCCGGCUGGGUGGGCGAGCAAUGCCAGCACUGCGGGGGCCGCUUCAGACUAACUGGAUCUUCUGGGUUUGUGACAGAUGGACCUGGAAAUUAUAAAUACAAAACGAAGUGCACGUGGCUCAUUGAAGGACAGCCAAAUAGAAUAAUGAGACUUCGUUUCAAUCAUUUUGCUACAGAGUGUAGUUGGGACCAUUUAUAUGUUUAUGAUGGGGACUCAAUUUAUGCACCGCUAGUUGCUGCAUUUAGUGGCCUCAUUGUUCCUGAGAGAGAUGGCAAUGAGACUGUCCCUGAGGUUGUUGCCACAUCAGGUUAUGCCUUGCUGCAUUUUUUUAGUGAUGCUGCUUAUAAUUUGACUGGAUUUAAUAUUACUUACAGUUUUGAUAUGUGUCCAAAUAACUGCUCAGGCCGAGGAGAGUGUAAGAUCAGUAAUAGCAGCGAUACUGUUGAAUGUGAAUGUUCUGAAAACUGGAAAGGUGAAGCAUGUGACAUUCCUCACUGUACAGACAACUGUGGUUUUCCUCAUCGAGGCAUCUGCAAUUCAAGUGAUGUCAGAGGAUGCUCCUGCUUCUCAGACUGGCAGGGUCCUGGAUGUUCAGUUCCUGUACCAGCUAACCAGUCAUUUUGGACUCGAGAGGAAUAUUCUAACUUAAAGCUCCCCAGAGCAUCUCAUAAAGCUGUGGUCAAUGGAAACAUUAUGUGGGUUGUUGGAGGAUAUAUGUUCAACCACUCAGAUUAUAACAUGGUUCUAGCGUAUGACCUUGCUUCUAGGGAGUGGCUUCCACUAAACCGUUCUGUGAACAAUGUGGUUGUUAGAUAUGGUCAUUCUUUGGCAUUAUACAAGGAUAAAAUUUACAUGUAUGGAGGAAAAAUUGAUUCAACUGGGAAUGUGACCAAUGAGUUGAGAGUUUUUCACAUUCAUAAUGAGUCAUGGGUGUUGUUGACCCCUAAGGCAAAGGAGCAGUAUGCAGUGGUUGGGCACUCUGCACACAUUGUUACACUGAAGAAUGGCCGAGUGGUCAUGCUGGUCAUCUUUGGUCACUGCCCUCUCUAUGGAUAUAUAAGCAAUGUGCAGGAAUAUGAUUUGGAUAAGAACACAUGGAGUAUAUUACACACCCAGGGUGCCCUUGUGCAAGGGGGUUACGGCCAUAGCAGUGUUUACGACCAUAGGACCAGGGCCCUAUACGUUCAUGGUGGCUACAAGGCUUUCAGUGCCAAUAAGUACCGGCUUGCAGAUGAUCUCUACCGAUAUGAUGUGGAUACCCAGAUGUGGACCAUUCUUAAGGACAGCCGAUUUUUCCGUUACUUGCACACAGCUGUGAUAGUGAGUGGAACCAUGCUGGUGUUUGGAGGAAACACACACAAUGACACAUCUAUGAGCCAUGGCGCCAAAUGCUUCUCUUCAGAUUUCAUGGCCUAUGACAUUGCCUGUGACCGCUGGUCAGUGCUUCCCAGACCUGAUCUCCACCAUGAUGUCAACAGAUUUGGCCAUUCAGCAGUCUUACACAACAGCACCAUGUAUGUGUUCGGUGGUUUCAAUAGUCUCCUCCUCAGCGACAUCCUGGUAUUCACCUCGGAACAGUGUGAUGCGCAUCGGAGUGAAGCCGCUUGUUUAGCAGCAGGACCUGGUAUUCGGUGUGUGUGGAACACAGGGUCGUCUCAGUGUAUCUCGUGGGCGCUGGCAACUGAUGAACAAGAAGAAAAGUUAAAAUCAGAAUGUUUUUCCAAAAGAACUCUUGACCAUGACAGAUGUGACCAGCACACAGAUUGUUACAGCUGCACAGCCAACACCAAUGACUGCCACUGGUGCAAUGACCAUUGUGUCCCCAGGAACCACAGCUGCUCAGAAGGCCAGAUCUCCAUUUUUAGGUAUGAGAAUUGCCCCAAGGAUAACCCCAUGUACUACUGUAACAAGAAGACCAGCUGCAGGAGCUGUGCCCUGGACCAGAACUGCCAGUGGGAGCCCCGGAAUCAGGAGUGCAUUGCCCUGCCCGAAAAUAUCUGUGGCAUUGGCUGGCAUUUGGUUGGAAACUCAUGUUUGAAAAUUACUACUGCCAAGGAGAAUUAUGACAAUGCUAAAUUGUUCUGUAGGAACCACAAUGCCCUUUUGGCUUCUCUUACAACCCAGAAGAAGGUAGAAUUUGUCCUUAAGCAGCUGCGAAUAAUGCAGUCAUCUCAGAGCAUGUCCAAGCUCACCUUAACCCCAUGGGUCGGCCUUCGGAAGAUCAAUGUGUCCUACUGGUGCUGGGAAGAUAUGUCCCCAUUUACAAAUAGUUUACUACAGUGGAUGCCGUCUGAGCCCAGUGAUGCUGGAUUCUGUGGAAUUUUAUCAGAACCCAGUACUCGGGGACUGAAGGCUGCAACCUGCAUCAACCCACUCAAUGGUAGUGUCUGUGAAAGGCCUGCAAACCACAGUGCUAAGCAGUGCCGGACACCAUGUGCCUUGAGGACAGCAUGUGGAGAUUGCACCAGCGGCAGCUCUGAGUGCAUGUGGUGCAGCAACAUGAAGCAGUGUGUGGACUCCAAUGCCUACGUGGCCUCCUUCCCUUUUGGCCAGUGUAUGGAAUGGUAUACGAUGAGCACCUGCCCCCCUGAAAAUUGUUCAGGCUACUGUACCUGUAGUCAUUGCUUGGAGCAACCAGGCUGUGGCUGGUGUACUGAUCCCAGCAAUACUGGCAAAGGGAAAUGCAUAGAGGGUUCCUAUAAAGGACCAGUGAAGAUGCCUUCGCAAGCCCCUACAGGAAAUUUCUAUCCACAGCCCCUGCUCAAUUCCAGCAUGUGUCUAGAGGACAGCAGAUACAACUGGUCUUUCAUUCACUGUCCAGCUUGCCAAUGCAACGGCCACAGUAAAUGCAUCAAUCAGAGCAUCUGUGAGAAGUGUGAGAACCUGACCACAGGCAAGCACUGCGAGACCUGCAUAUCUGGCUUCUACGGUGAUCCCACCAAUGGAGGGAAAUGUCAGCCAUGCAAGUGCAAUGGGCACGCGUCUCUGUGCAACACCAACACGGGCAAGUGCUUCUGCACCACCAAGGGCGUCAAGGGGGACGAGUGCCAGCUAUGUGAGGUAGAAAAUCGAUACCAAGGAAACCCUCUCAGAGGAACAUGUUAUUAUACUCUUCUUAUUGACUAUCAGUUCACCUUUAGUCUAUCCCAGGAAGAUGAUCGCUAUUACACAGCUAUCAAUUUUGUGGCUACUCCUGACGAACAAAACAGGGAUUUGGACAUGUUCAUCAAUGCCUCCAAGAAUUUCAACCUCAACAUCACCUGGGCUGCCAGUUUCUCAGCUGGAACCCAGGCUGGAGAAGAGAUGCCUGUUGUUUCAAAAACCAACAUUAAGGAGUACAAAGAUAGUUUCUCUAAUGAGAAGUUUGAUUUUCGCAACCACCCAAAUAUCACUUUCUUUGUUUAUGUCAGUAAUUUCACCUGGCCCAUCAAAAUUCAGAUUGCCUUCUCUCAGCACAGCAAUUUUAUGGACCUGGUACAGUUCUUCGUGACUUUCUUCAGUUGUUUCCUCUCUUUGCUCCUGGUGGCUGCUGUGGUUUGGAAGAUCAAACAAAGUUGUUGGGCCUCCAGACGUAGAGAGCAACUUCUUCGAGAGAUGCAACAGAUGGCCAGCCGUCCCUUUGCCUCUGUAAAUGUCGCCUUGGAAACAGAUGAGGAGCCUCCUGAUCUUAUUGGGGGGAGUAUAAAGACUGUUCCCAAACCCAUUGCACUGGAGCCGUGUUUUGGCAACAAAGCCGCUGUCCUCUCUGUGUUUGUGAGGCUCCCUCGAGGCCUGGGUGGCAUCCCUCCUCCUGGGCAGUCAGGUCUUGCUGUGGCCAGCGCCCUGGUGGACAUUUCUCAGCAGAUGCCGAUAGUGUACAAGGAGAAGUCAGGAGCCGUGAGAAACCGGAAGCAGCAGCCCCCUGCACAGCCUGGGACCUGCAUCUGAUGCUGGGGCCAGGGACUCUCCCACGCACGAGCUAGUGAGUGGCACACCAGAGCCAUCUGCAGGGAAGGGCGUGGCGGGGAAAUGGCUGUGCGGUGCGGGACGGAAGACUGGAAACCCUCAAAGCAUCUGACUCACCUGCAUGAUCACAAGCUUUCUUUGACGGUUUCUCCCAUCCGUGUUCCAGCAUCUAACCUUUUACUUUUGCAUAGGAAAUACUUGAUUUAAUUACAGGUCCAGGGAUGAGCUGAUGGUUGCUGGAGGAGGCCAGUGUAGAGCCAGUGAGAGAACUAGGAAUGACACUCAGGUUCACUGUGGAAAACUGUUCUUGGGACUGUCUCAACUGUGCAAAAAACAAAAGAUGGAGUGUUUACAAGUAGACAUUCGUCAUCAGUUGUUCUUGAACAUGGUCUUUUAAAAACUAGUCAGAUGAAUUGUUUUCAUCUGAAGCCUGCUAUCUUUUUUAAAAGAUGUGCUAUUUAUUCUUGCACGAUUUAGGCAAUUAUCUCUCUUCCAGGGAGUACCUUUUUUUCUAGUUGAGAAUUAAUAAUGGUCCAUCUCUUUUGAUCAUAUCAAGCUAGGAUAGAAGGGGGGCUAUUUUAAAUGUCAAGGUCAGCAGUGUUACUUUGAAUGUAAACUGGUAUAAUAGGUAGUUUUCUAUAGUAACUUGAUUAAUUUAGUCUUAAUCCAUUUGAAACUCUCUCUUCCUUUCUCUCUGCCUGUCCCUCUCCUUCUCCAUCUCACCCUCCCUCUCUCACACAUACACACACAAACACAUACACACAACACUAAGUGCCUAGACUUUAAAUAGAUCUAGCAAUUGGAAAGUUAGUAAGCCUAAGUUUUUACAUAAUUGCAUUCCUACAUUCUUGUAAAAUUUAAAUAGCUACCAUUGGCAAUCUGCUUUUUUUCUAAAAUCUGAUUUGCAGCCAGGAAAGAAUUUUCUCACCCAAGGAACAUUUGAUCUAGCAGCAGGGAUGAGAGGAAAGCAGAAAUGAAUGAACUGUGAAAGCUCCUGUUUUUAUUAUCAAAAAGGACACUGUCAAGAAGGCGCCCCCUGCCCCCACCCCCGUGUCACCCUAGGCCUGAUAAGCGAUCAGAGGAAAGGACUCAUUCAUGUCACGCUUCCUUGAGCAGAAAAGAGCACUGAGAGCACUUGGGACCCCUGGAUCAGAGAGCAUCUGUGUGUCCUGCAGCCUCCUCUGAACUUGUGGUUCAUUCUCAGGCUGGGGUGGACUCAGAUGCCAGGAAAGGGACAGCCUCCCAUUGUCAGGCAGAAGCUGCCCAAAGCCUGGAGAAGGACUUGUUUGCCCUCUUUCCCCCAGGAGGGGCUCGACCCACCCACCCUCCCUCUCAGACCAAGGUGGUGGCUGUGAGGAGGGCAGCAAAUGCUGACAAGGAUGAAAAGCACAUGGAAAAAAAUGGAUGAGGAGGGAAAACUCUGCCAAAUGGAAAAUGACCAAAUUUAAGAGGGUGGGACAGUCCCCUGCUCCUCUCCCAGAGGGCACUGCUUGGAAAUUGUGUUUUCCCCAUUUAUGGUGCUCUGUAUUCUGGCAUUAUGCAGCAGCCUCCCAGAAGCUCUCUUCUGCUUCAAAACCUGGGAUCUCUGGCAUUACCCUAUUGGGAUGGACCGCUGGACAGCAAUGCUCGAGUUUGUGAAUUUGGAGAGAUACUCAAAAGAGCUAAAACUGCAGCAUUUUACCUUUAAAUGCAGUGCCUAGAGAGAGAGUAUUGUCUCUUCCCCAACACUAACCCCACUCCCAUGAAGAAUUGCCUGGAAAGAUGUUUUCAAGGAAUUUGAACCAUAAAACACUAUCUGAUGCACAGAACACCUCUACUUUGAGACUCACCUCUCAUAAAGCUUCUUUUUCACAUUACUGUUAAAGACCAGACGUUCUAGAAAAGACCCCUCCUCUCAUGAGCUCCCCCAUCCCUGCUACAGAACACAGCACCCAUGGCGCCUGCAGUGGACUGGCCCCUUAAUUCCCACAGGCCCCCCCAGCAAGGCCAAAGGGAGGCCCCUGGGUAUUGUCCUCCUACAAGGAAGAUCCUCUUUGUUUGUUCAAAGGACCAGUUUUCCUAGGCCAAAGAAGUCUCUUCCCCAUGUUAGUCCUAUGCCUUGAAAUAUCAUGCACCAUGACCCACAGCCAUCUGGUUAUGUCUUAUUUUUUUCCUAAAAGAUAAUGUUUAUUUUUAAAAAGGAAGGAAGGAGCAAGUGAAGUUUCAUUCUGCUCCAGCGGUGGGGAAGCCGCUGAAUCCACCUGCUUCUCCUUUGCAACCGACAGCAAACAGCUUUCUCCGGCCUCAGGGCAGAAAAAGGGAAUGGCAGGGAGUAAGAGGCGCUGGGCUCGGAGCCUGUUUCCAAGAAGGAAUUGGUUGUCAUCUGGCAGUGUUGCGCGUCACAAGAGAGCCUGUAUAUAAAUUAAAAUAGUCAAGACAACACUGACCUUGCACUUGUACAUAACUAUACAGUAGUGUCCAGAAUGUUCAGACAUUCGGAGUGUACAUAAAACAGAAAAAAUCUUCAUGUAUUUUUAUUAAAUAUAACAAUGUCUGAGUUUCACCUAAGAUGUUUUUGUGCCAUAUGCUGGAUAUCCAGGUUCUCGCCAGGCCCCGAUACAUGAAUAACAAACCCAAGAAACGCAUCCCCAUUGUGUGAUGUGUUCAGAUGCAUCUGGCACCAAUUAGGUAUUUCUUAAAACAGGACUCAUCUGUCAGAGUGCACAUGAAAAAUCAGGCAGGGAAUCGAAACGACAGUGCUGGAGGAGACUCAGGAAGCAGAGGCGUCCCUGCCGCUGCCCUUGGCCCUGCAAGCACAUCAUGACCCUUUCUGGCAGCCUCUUGGUGCUCUGGGUAGUGAGGGAUGACCAGUCUUGUCCUGAGAAAUGUUUCUCUUAGUCUUUAAGUUCAAAGACUAACCUGUAGCAAUCAGACUUUCCAAAAGGGGGUUCUCCAUUUUUUGUAGUUUUGUCUAAAUUUUUAAUGACCAUUUCCUGGAAUCAGUUUAUUAUACUGAAAACUGGGGGUGGGAGUAGGGAGCUAGUUUGUUGAUAAAUAGUUCCCAUUUCCCCAUGGAGAAUUUGACAUACCCUGGACUCCUGUGUGCCUCCUGCCAUCCCUGCACACAGCCUGGGGAGAAGCCUGUGCCUCCCCGUGUGGAGAGAAGGCAACCCCAGAUCCCCUGAGCUAACCCGGAGGAAAGGCAGUCCUGGACAGAAGACUGUCAGCAGAAGGAAAGUACUGGACUACCCGUGGGUAAGUCCUGCCAUUCAAGACUGGAGACACCUGGGAAAUAAAAAGAGCAGGGCACUGCUGGUGGGAAGAGGCAUUUUACCUUCCAGUGCAAAUCCUGCUCCUUUGAUUUAAUGGGGUGUACUGGGGCCAGGGGCUGAUUCACUUCCUUGGGAGAUGGUGGUGUUUUCAUGAACAUCUUUGAUCCUUCCAUUUCAUUUAUUCAUCCAUCCAUUCAACAAGUAUUUGCUAAACACUAACUUAAGCUAAUGCUAGGGUAGUGACUGAGAUGUAAAAAUAGAUUUUAGAAUUAAAACAAAAUCCAAGUCCUCACACCCCUGUCAUCCCAGGAGAUCUUUCCUUGUGGUGGUUUCUGUGAGAAUUGGCCAUCCUGAGGACACAGCCAGGACGGCAGAGGCCUCCUGGCCUCAGGGCAUGCCCUGCCUACCUUCUGAAAUGUUUACCCCAUUGACCAAACUUGGCUCCAGCCAUUGCGGUGGUUUCUAGAUAGCCAGGCCCACCAAGAGAUAUUGCCCCUUGAUGAGAGUCAAACACCCUGCCUACAAGGAGAUGUUUUGAAAUGGAGAGGAAAAUUGGCACCUCAUCUUUUAAAGGCAGUAAUGGAAUUGAUUUUCAGUAACUGAAUUUGUGCACAAAACAUUCUAAACACUAGUGAAGCCUGUUUCGUUGAACUAAUUCUGGCUCUGGAAAUGUUUUUGUUUUAUAGUUAUUUACGAUUUCGUUUGUUUGGAUUCAAGCUUAGUUUGUUAAUAUGUAUAAUUUAGCAUCUAUUACACUCAUGUAAAUAUGGAGUAAGUAUUGUAAACUAUUUCAUCGCGGGGAUUGUGGGUGUUAUACAUACAUUUAGGACUGCAAUUUUUUGGUAUUUUUUGUAUUGUAAAAUAACAGCUAAUUUAAGCAGGAACAAGAGAACUAAGGGAGGUCUGUGCAUUUUAAACACAAAUGUGAAGAACUUGUAUAUAAACAAAAGUAAAUACUAUAAUACAAACUUCCUUCUGAAAUAAAAGUAGAUCUGGUAAAAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 8455)
attractin
strand +
DPPT-L, MGCA
885
NCBI CDS gene sequence (4290 bp)
5'-ATGGTGGCTGCAGCGGCGGCAACTGAGGCAAGGCTGAGGAGGAGGACGGCGGCGACGGCAGCGCTCGCGGGCAGGAGCGGCGGGCCGCACTGGGACTGGGACGTGACCAGGGCTGGGAGGCCGGGGCTGGGGGCCGGGCTGCGCCTCCCGCGGCTGCTGTCTCCACCGCTGCGGCCACGGCTGCTGCTGCTGCTGTTGTTGCTCTCGCCGCCGCTGCTGCTGCTGCTGCTGCCCTGTGAGGCCGAGGCCGCGGCGGCGGCGGCGGCGGTGTCGGGCTCAGCCGCAGCCGAGGCCAAGGAATGTGACCGGCCCTGTGTCAACGGCGGTCGCTGCAACCCTGGCACCGGCCAGTGCGTCTGCCCCGCCGGCTGGGTGGGCGAGCAATGCCAGCACTGCGGGGGCCGCTTCAGACTAACTGGATCTTCTGGGTTTGTGACAGATGGACCTGGAAATTATAAATACAAAACGAAGTGCACGTGGCTCATTGAAGGACAGCCAAATAGAATAATGAGACTTCGTTTCAATCATTTTGCTACAGAGTGTAGTTGGGACCATTTATATGTTTATGATGGGGACTCAATTTATGCACCGCTAGTTGCTGCATTTAGTGGCCTCATTGTTCCTGAGAGAGATGGCAATGAGACTGTCCCTGAGGTTGTTGCCACATCAGGTTATGCCTTGCTGCATTTTTTTAGTGATGCTGCTTATAATTTGACTGGATTTAATATTACTTACAGTTTTGATATGTGTCCAAATAACTGCTCAGGCCGAGGAGAGTGTAAGATCAGTAATAGCAGCGATACTGTTGAATGTGAATGTTCTGAAAACTGGAAAGGTGAAGCATGTGACATTCCTCACTGTACAGACAACTGTGGTTTTCCTCATCGAGGCATCTGCAATTCAAGTGATGTCAGAGGATGCTCCTGCTTCTCAGACTGGCAGGGTCCTGGATGTTCAGTTCCTGTACCAGCTAACCAGTCATTTTGGACTCGAGAGGAATATTCTAACTTAAAGCTCCCCAGAGCATCTCATAAAGCTGTGGTCAATGGAAACATTATGTGGGTTGTTGGAGGATATATGTTCAACCACTCAGATTATAACATGGTTCTAGCGTATGACCTTGCTTCTAGGGAGTGGCTTCCACTAAACCGTTCTGTGAACAATGTGGTTGTTAGATATGGTCATTCTTTGGCATTATACAAGGATAAAATTTACATGTATGGAGGAAAAATTGATTCAACTGGGAATGTGACCAATGAGTTGAGAGTTTTTCACATTCATAATGAGTCATGGGTGTTGTTGACCCCTAAGGCAAAGGAGCAGTATGCAGTGGTTGGGCACTCTGCACACATTGTTACACTGAAGAATGGCCGAGTGGTCATGCTGGTCATCTTTGGTCACTGCCCTCTCTATGGATATATAAGCAATGTGCAGGAATATGATTTGGATAAGAACACATGGAGTATATTACACACCCAGGGTGCCCTTGTGCAAGGGGGTTACGGCCATAGCAGTGTTTACGACCATAGGACCAGGGCCCTATACGTTCATGGTGGCTACAAGGCTTTCAGTGCCAATAAGTACCGGCTTGCAGATGATCTCTACCGATATGATGTGGATACCCAGATGTGGACCATTCTTAAGGACAGCCGATTTTTCCGTTACTTGCACACAGCTGTGATAGTGAGTGGAACCATGCTGGTGTTTGGAGGAAACACACACAATGACACATCTATGAGCCATGGCGCCAAATGCTTCTCTTCAGATTTCATGGCCTATGACATTGCCTGTGACCGCTGGTCAGTGCTTCCCAGACCTGATCTCCACCATGATGTCAACAGATTTGGCCATTCAGCAGTCTTACACAACAGCACCATGTATGTGTTCGGTGGTTTCAATAGTCTCCTCCTCAGCGACATCCTGGTATTCACCTCGGAACAGTGTGATGCGCATCGGAGTGAAGCCGCTTGTTTAGCAGCAGGACCTGGTATTCGGTGTGTGTGGAACACAGGGTCGTCTCAGTGTATCTCGTGGGCGCTGGCAACTGATGAACAAGAAGAAAAGTTAAAATCAGAATGTTTTTCCAAAAGAACTCTTGACCATGACAGATGTGACCAGCACACAGATTGTTACAGCTGCACAGCCAACACCAATGACTGCCACTGGTGCAATGACCATTGTGTCCCCAGGAACCACAGCTGCTCAGAAGGCCAGATCTCCATTTTTAGGTATGAGAATTGCCCCAAGGATAACCCCATGTACTACTGTAACAAGAAGACCAGCTGCAGGAGCTGTGCCCTGGACCAGAACTGCCAGTGGGAGCCCCGGAATCAGGAGTGCATTGCCCTGCCCGAAAATATCTGTGGCATTGGCTGGCATTTGGTTGGAAACTCATGTTTGAAAATTACTACTGCCAAGGAGAATTATGACAATGCTAAATTGTTCTGTAGGAACCACAATGCCCTTTTGGCTTCTCTTACAACCCAGAAGAAGGTAGAATTTGTCCTTAAGCAGCTGCGAATAATGCAGTCATCTCAGAGCATGTCCAAGCTCACCTTAACCCCATGGGTCGGCCTTCGGAAGATCAATGTGTCCTACTGGTGCTGGGAAGATATGTCCCCATTTACAAATAGTTTACTACAGTGGATGCCGTCTGAGCCCAGTGATGCTGGATTCTGTGGAATTTTATCAGAACCCAGTACTCGGGGACTGAAGGCTGCAACCTGCATCAACCCACTCAATGGTAGTGTCTGTGAAAGGCCTGCAAACCACAGTGCTAAGCAGTGCCGGACACCATGTGCCTTGAGGACAGCATGTGGAGATTGCACCAGCGGCAGCTCTGAGTGCATGTGGTGCAGCAACATGAAGCAGTGTGTGGACTCCAATGCCTACGTGGCCTCCTTCCCTTTTGGCCAGTGTATGGAATGGTATACGATGAGCACCTGCCCCCCTGAAAATTGTTCAGGCTACTGTACCTGTAGTCATTGCTTGGAGCAACCAGGCTGTGGCTGGTGTACTGATCCCAGCAATACTGGCAAAGGGAAATGCATAGAGGGTTCCTATAAAGGACCAGTGAAGATGCCTTCGCAAGCCCCTACAGGAAATTTCTATCCACAGCCCCTGCTCAATTCCAGCATGTGTCTAGAGGACAGCAGATACAACTGGTCTTTCATTCACTGTCCAGCTTGCCAATGCAACGGCCACAGTAAATGCATCAATCAGAGCATCTGTGAGAAGTGTGAGAACCTGACCACAGGCAAGCACTGCGAGACCTGCATATCTGGCTTCTACGGTGATCCCACCAATGGAGGGAAATGTCAGCCATGCAAGTGCAATGGGCACGCGTCTCTGTGCAACACCAACACGGGCAAGTGCTTCTGCACCACCAAGGGCGTCAAGGGGGACGAGTGCCAGCTATGTGAGGTAGAAAATCGATACCAAGGAAACCCTCTCAGAGGAACATGTTATTATACTCTTCTTATTGACTATCAGTTCACCTTTAGTCTATCCCAGGAAGATGATCGCTATTACACAGCTATCAATTTTGTGGCTACTCCTGACGAACAAAACAGGGATTTGGACATGTTCATCAATGCCTCCAAGAATTTCAACCTCAACATCACCTGGGCTGCCAGTTTCTCAGCTGGAACCCAGGCTGGAGAAGAGATGCCTGTTGTTTCAAAAACCAACATTAAGGAGTACAAAGATAGTTTCTCTAATGAGAAGTTTGATTTTCGCAACCACCCAAATATCACTTTCTTTGTTTATGTCAGTAATTTCACCTGGCCCATCAAAATTCAGATTGCCTTCTCTCAGCACAGCAATTTTATGGACCTGGTACAGTTCTTCGTGACTTTCTTCAGTTGTTTCCTCTCTTTGCTCCTGGTGGCTGCTGTGGTTTGGAAGATCAAACAAAGTTGTTGGGCCTCCAGACGTAGAGAGCAACTTCTTCGAGAGATGCAACAGATGGCCAGCCGTCCCTTTGCCTCTGTAAATGTCGCCTTGGAAACAGATGAGGAGCCTCCTGATCTTATTGGGGGGAGTATAAAGACTGTTCCCAAACCCATTGCACTGGAGCCGTGTTTTGGCAACAAAGCCGCTGTCCTCTCTGTGTTTGTGAGGCTCCCTCGAGGCCTGGGTGGCATCCCTCCTCCTGGGCAGTCAGGTCTTGCTGTGGCCAGCGCCCTGGTGGACATTTCTCAGCAGATGCCGATAGTGTACAAGGAGAAGTCAGGAGCCGTGAGAAACCGGAAGCAGCAGCCCCCTGCACAGCCTGGGACCTGCATCTGA-3'
NCBI CDS gene sequence with introns (location: 3471108.. 3646847) (175740 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 3471018.. 3651118) (180101 bp)Download
NCBI gene sequence (location: [3471018 - 1000].. 3651118) (181101 bp)Download
Cite How to cite