NCBI Summary
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011].
Protein
Protein (NP_612210)
C-type lectin domain family 12 member A
C-type lectin domain family 12 member A (C-type lectin-like molecule 1) (CLL-1) (Dendritic cell-associated lectin 2) (DCAL-2) (Myeloid inhibitory C-type lectin-like receptor) (MICL) (CD antigen CD371)
CLEC12A
C-type lectin domain family 12 member A
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
Uncharacterised
0.375
Protein sequence and protein families (fasta) (265 amino acids) Download
MSEEVTYADLQFQNSSEMEKIPEIGKFGEKAPPAPSHVWRPAALFLTLLCLLLLIGLGVLASMFHVTLKIEMKKMNKLQNISEELQRNISLQLMSNMNISNKIRNLSTTLQTIATKLCRELYSKEQEHKCKPCPRRWIWHKDSCYFLSDDVQTWQESKMACAAQNASLLKINNKNALEFIKSQSRSYDYWLGLSPEEDSTRGMRVDNIINSSAWVIRNAPDLNNMYCGYINRLYVQYYHCTYKKRMICEKMANPVQLGSTYFREA
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.61, 2.1] ÅDownload
The location of the lectin domain structural model is: 105-256
We infer [1.61, 2.1] Å as the interval of error of this structural model.
Template 1: 4ZES chain: A, Q8WTT0, NP_569708.1, sequence identity: 24.3%, coverage: 90.8%, location in sequence: 67-213, (67-213 in PDB).
Template 2: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 22.4%, coverage: 95.4%, location in sequence: 63-215, (63-215 in PDB).
Template 3: 5VYB chain: A, Q6EIG7, NP_001007034.1, sequence identity: 21.7%, coverage: 90.8%, location in sequence: 63-209, (63-209 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Regulation of the Expression, Oligomerisation and Signaling of the Inhibitory Receptor CLEC12A by Cysteine Residues in the Stalk Region. [34638548]
  • The Inhibitory Receptor CLEC12A Regulates PI3K-Akt Signaling to Inhibit Neutrophil Activation and Cytokine Release. [34234773]
  • C-Type Lectin-Like Molecule-1 as a Biomarker for Diagnosis and Prognosis in Acute Myeloid Leukemia: A Preliminary Study. [33778076]
  • CLEC12A and CD33 coexpression as a preferential target for pediatric AML combinatorial immunotherapy. [33094319]
  • Blast cells in acute megakaryoblastic leukaemia with Down syndrome are characterized by low CLEC12A expression. [33095915]
  • Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. [16838277]
  • KLRL1, a novel killer cell lectinlike receptor, inhibits natural killer cell cytotoxicity. [15238421]
  • Identification and characterization of a novel human myeloid inhibitory C-type lectin-like receptor (MICL) that is predominantly expressed on granulocytes and monocytes. [14739280]
  • Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. [12945048]
  • C-type lectin-like domains. [10508765]
UniProt Main References (6 PubMed Identifiers)
  • C-type lectin-like molecule-1: a novel myeloid cell surface marker associated with acute myeloid leukemia. [15548716]
  • Dendritic-cell-associated C-type lectin 2 (DCAL-2) alters dendritic-cell maturation and cytokine production. [16239426]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The finished DNA sequence of human chromosome 12. [16541075]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
All isoforms of this gene containing a lectin domain
NP_963917.2, XP_011518873.2, NP_612210.4, XP_005253381.1, XP_011518872.1, NP_001193939.1, XP_006719096.1, XP_011518875.1, NP_001287659.1, XP_006719098.1, XP_006719099.1
RNA
RNA (Transcript ID: NM_138337.6)
C-type lectin domain family 12 member A, transcript variant 1
m7G-5')ppp(5'-GGCUCAUUUGCAGACAUAUGGGUGAUUGGUACAGUAGGUUUAUAAACAGAAGUUUAAACUUGUAAGCUUAAGCUUCCGUUUAUAAACAGAAGUUUAAAAUUAUAGGUCCUGUUUAACAUUCAGCUCUGUUAACUCACUCAUCUUUUUGUGUUUUUACACUUUGUCAAGAUUUCUUUACAUAUUCAUCAAUGUCUGAAGAAGUUACUUAUGCAGAUCUUCAAUUCCAGAACUCCAGUGAGAUGGAAAAAAUCCCAGAAAUUGGCAAAUUUGGGGAAAAAGCACCUCCAGCUCCCUCUCAUGUAUGGCGUCCAGCAGCCUUGUUUCUGACUCUUCUGUGCCUUCUGUUGCUCAUUGGAUUGGGAGUCUUGGCAAGCAUGUUUCACGUAACUUUGAAGAUAGAAAUGAAAAAAAUGAACAAACUACAAAACAUCAGUGAAGAGCUCCAGAGAAAUAUUUCUCUACAACUGAUGAGUAACAUGAAUAUCUCCAACAAGAUCAGGAACCUCUCCACCACACUGCAAACAAUAGCCACCAAAUUAUGUCGUGAGCUAUAUAGCAAAGAACAAGAGCACAAAUGUAAGCCUUGUCCAAGGAGAUGGAUUUGGCAUAAGGACAGCUGUUAUUUCCUAAGUGAUGAUGUCCAAACAUGGCAGGAGAGUAAAAUGGCCUGUGCUGCUCAGAAUGCCAGCCUGUUGAAGAUAAACAACAAAAAUGCAUUGGAAUUUAUAAAAUCCCAGAGUAGAUCAUAUGACUAUUGGCUGGGAUUAUCUCCUGAAGAAGAUUCCACUCGUGGUAUGAGAGUGGAUAAUAUAAUCAACUCCUCUGCCUGGGUUAUAAGAAACGCACCUGACUUAAAUAACAUGUAUUGUGGAUAUAUAAAUAGACUAUAUGUUCAAUAUUAUCACUGCACUUAUAAAAAAAGAAUGAUAUGUGAGAAGAUGGCCAAUCCAGUGCAGCUUGGUUCUACAUAUUUUAGGGAGGCAUGAGGCAUCAAUCAAAUACAUUUAAGGAGUGUAGGGGGUGGGGGUUCUAGGCUAUAGGUAAAUUUAAAUAUUUUCUGGUUGACAAUUAGUUGAGUUUGUCUGAAGACCUGGGAUUUUAUCAUGCAGAUGAAACAUCCAGGUAGCAAGCUUCAGAGAGAAUAGACUGUGAAUGUUAAUGCCAGAGAGGUAUAAUGAAGCAUGUCCCACCUCCCACUUUCCAUCAUGGCCUGAACCCUGGAGGAAGAGGAAGUCCAUUCAGAUAGUUGUGGGGGGCCUUCGAAUUUUCAUUUUCAUUUACGUUCUUCCCCUUCUGGCCAAGAUUUGCCAGAGGCAACAUCAAAAACCAGCAAAUUUUAAUUUUGUCCCACAGCGUUGCUAGGGUGGCAUGGCUCCCCAUCUCGGGUCCAUCCUAUACUUCCAUGGGACUCCCUAUGGCUGAAGGCCUUAUGAGUCAAAGGACUUAUAGCCAAUUGAUUGUUCUAGGCCAGGUAAGAAUGGAUAUGGACAUGCAUUUAUUACCUCUUAAAAUUAUUAUUUUAAGUAAAAGCCAAUAAACAAAAACGAAAAGGCAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 160364)
C-type lectin domain family 12 member A
strand +
CLL-1, MICL, CD371, DCAL-2
NCBI CDS gene sequence (798 bp)
5'-ATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGAACTCCAGTGAGATGGAAAAAATCCCAGAAATTGGCAAATTTGGGGAAAAAGCACCTCCAGCTCCCTCTCATGTATGGCGTCCAGCAGCCTTGTTTCTGACTCTTCTGTGCCTTCTGTTGCTCATTGGATTGGGAGTCTTGGCAAGCATGTTTCACGTAACTTTGAAGATAGAAATGAAAAAAATGAACAAACTACAAAACATCAGTGAAGAGCTCCAGAGAAATATTTCTCTACAACTGATGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTCCACCACACTGCAAACAATAGCCACCAAATTATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGTAAGCCTTGTCCAAGGAGATGGATTTGGCATAAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACATGGCAGGAGAGTAAAATGGCCTGTGCTGCTCAGAATGCCAGCCTGTTGAAGATAAACAACAAAAATGCATTGGAATTTATAAAATCCCAGAGTAGATCATATGACTATTGGCTGGGATTATCTCCTGAAGAAGATTCCACTCGTGGTATGAGAGTGGATAATATAATCAACTCCTCTGCCTGGGTTATAAGAAACGCACCTGACTTAAATAACATGTATTGTGGATATATAAATAGACTATATGTTCAATATTATCACTGCACTTATAAAAAAAGAATGATATGTGAGAAGATGGCCAATCCAGTGCAGCTTGGTTCTACATATTTTAGGGAGGCATGA-3'
NCBI CDS gene sequence with introns (location: 9971597.. 9985026) (13430 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 9971409.. 9985595) (14187 bp)Download
NCBI gene sequence (location: [9971409 - 1000].. 9985595) (15187 bp)Download
Cite How to cite