NCBI Summary
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011].
Protein
Protein (NP_612210)
C-type lectin domain family 12 member A
C-type lectin domain family 12 member A (C-type lectin-like molecule 1) (CLL-1) (Dendritic cell-associated lectin 2) (DCAL-2) (Myeloid inhibitory C-type lectin-like receptor) (MICL) (CD antigen CD371)
CLEC12A
C-type lectin domain family 12 member A
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
Uncharacterised
0.375
MSEEVTYADLQFQNSSEMEKIPEIGKFGEKAPPAPSHVWRPAALFLTLLCLLLLIGLGVLASMFHVTLKIEMKKMNKLQNISEELQRNISLQLMSNMNISNKIRNLSTTLQTIATKLCRELYSKEQEHKCKPCPRRWIWHKDSCYFLSDDVQTWQESKMACAAQNASLLKINNKNALEFIKSQSRSYDYWLGLSPEEDSTRGMRVDNIINSSAWVIRNAPDLNNMYCGYINRLYVQYYHCTYKKRMICEKMANPVQLGSTYFREA
No structure currently available in the PDB RCSB Databank.
Structural models
SWISS-MODEL structural models
The location of the lectin domain structural model is: 105-256
We infer [1.61, 2.1] Å as the interval of error of this structural model.
Template 1: 4ZES chain: A, Q8WTT0, NP_569708.1, sequence identity: 24.3%, coverage: 90.8%, location in sequence: 67-213, (67-213 in PDB).
Template 2: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 22.4%, coverage: 95.4%, location in sequence: 63-215, (63-215 in PDB).
Template 3: 5VYB chain: A, Q6EIG7, NP_001007034.1, sequence identity: 21.7%, coverage: 90.8%, location in sequence: 63-209, (63-209 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
We infer [1.61, 2.1] Å as the interval of error of this structural model.
Template 1: 4ZES chain: A, Q8WTT0, NP_569708.1, sequence identity: 24.3%, coverage: 90.8%, location in sequence: 67-213, (67-213 in PDB).
Template 2: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 22.4%, coverage: 95.4%, location in sequence: 63-215, (63-215 in PDB).
Template 3: 5VYB chain: A, Q6EIG7, NP_001007034.1, sequence identity: 21.7%, coverage: 90.8%, location in sequence: 63-209, (63-209 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Oligomerization and Known Interactions
Homodimer; disulfide-linked (By similarity). Interacts (when the ITIM motif is phosphorylated) with PTPN6 and PTPN11 (PubMed:14739280). Source: UniProt
Annotation
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Regulation of the Expression, Oligomerisation and Signaling of the Inhibitory Receptor CLEC12A by Cysteine Residues in the Stalk Region. [34638548]
- The Inhibitory Receptor CLEC12A Regulates PI3K-Akt Signaling to Inhibit Neutrophil Activation and Cytokine Release. [34234773]
- C-Type Lectin-Like Molecule-1 as a Biomarker for Diagnosis and Prognosis in Acute Myeloid Leukemia: A Preliminary Study. [33778076]
- CLEC12A and CD33 coexpression as a preferential target for pediatric AML combinatorial immunotherapy. [33094319]
- Blast cells in acute megakaryoblastic leukaemia with Down syndrome are characterized by low CLEC12A expression. [33095915]
- Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. [16838277]
- KLRL1, a novel killer cell lectinlike receptor, inhibits natural killer cell cytotoxicity. [15238421]
- Identification and characterization of a novel human myeloid inhibitory C-type lectin-like receptor (MICL) that is predominantly expressed on granulocytes and monocytes. [14739280]
- Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. [12945048]
- C-type lectin-like domains. [10508765]
UniProt Main References (6 PubMed Identifiers)
- C-type lectin-like molecule-1: a novel myeloid cell surface marker associated with acute myeloid leukemia. [15548716]
- Dendritic-cell-associated C-type lectin 2 (DCAL-2) alters dendritic-cell maturation and cytokine production. [16239426]
- Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
- The finished DNA sequence of human chromosome 12. [16541075]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_138337.6)
C-type lectin domain family 12 member A, transcript variant 1
m7G-5')ppp(5'-GGCUCAUUUGCAGACAUAUGGGUGAUUGGUACAGUAGGUUUAUAAACAGAAGUUUAAACUUGUAAGCUUAAGCUUCCGUUUAUAAACAGAAGUUUAAAAUUAUAGGUCCUGUUUAACAUUCAGCUCUGUUAACUCACUCAUCUUUUUGUGUUUUUACACUUUGUCAAGAUUUCUUUACAUAUUCAUCAAUGUCUGAAGAAGUUACUUAUGCAGAUCUUCAAUUCCAGAACUCCAGUGAGAUGGAAAAAAUCCCAGAAAUUGGCAAAUUUGGGGAAAAAGCACCUCCAGCUCCCUCUCAUGUAUGGCGUCCAGCAGCCUUGUUUCUGACUCUUCUGUGCCUUCUGUUGCUCAUUGGAUUGGGAGUCUUGGCAAGCAUGUUUCACGUAACUUUGAAGAUAGAAAUGAAAAAAAUGAACAAACUACAAAACAUCAGUGAAGAGCUCCAGAGAAAUAUUUCUCUACAACUGAUGAGUAACAUGAAUAUCUCCAACAAGAUCAGGAACCUCUCCACCACACUGCAAACAAUAGCCACCAAAUUAUGUCGUGAGCUAUAUAGCAAAGAACAAGAGCACAAAUGUAAGCCUUGUCCAAGGAGAUGGAUUUGGCAUAAGGACAGCUGUUAUUUCCUAAGUGAUGAUGUCCAAACAUGGCAGGAGAGUAAAAUGGCCUGUGCUGCUCAGAAUGCCAGCCUGUUGAAGAUAAACAACAAAAAUGCAUUGGAAUUUAUAAAAUCCCAGAGUAGAUCAUAUGACUAUUGGCUGGGAUUAUCUCCUGAAGAAGAUUCCACUCGUGGUAUGAGAGUGGAUAAUAUAAUCAACUCCUCUGCCUGGGUUAUAAGAAACGCACCUGACUUAAAUAACAUGUAUUGUGGAUAUAUAAAUAGACUAUAUGUUCAAUAUUAUCACUGCACUUAUAAAAAAAGAAUGAUAUGUGAGAAGAUGGCCAAUCCAGUGCAGCUUGGUUCUACAUAUUUUAGGGAGGCAUGAGGCAUCAAUCAAAUACAUUUAAGGAGUGUAGGGGGUGGGGGUUCUAGGCUAUAGGUAAAUUUAAAUAUUUUCUGGUUGACAAUUAGUUGAGUUUGUCUGAAGACCUGGGAUUUUAUCAUGCAGAUGAAACAUCCAGGUAGCAAGCUUCAGAGAGAAUAGACUGUGAAUGUUAAUGCCAGAGAGGUAUAAUGAAGCAUGUCCCACCUCCCACUUUCCAUCAUGGCCUGAACCCUGGAGGAAGAGGAAGUCCAUUCAGAUAGUUGUGGGGGGCCUUCGAAUUUUCAUUUUCAUUUACGUUCUUCCCCUUCUGGCCAAGAUUUGCCAGAGGCAACAUCAAAAACCAGCAAAUUUUAAUUUUGUCCCACAGCGUUGCUAGGGUGGCAUGGCUCCCCAUCUCGGGUCCAUCCUAUACUUCCAUGGGACUCCCUAUGGCUGAAGGCCUUAUGAGUCAAAGGACUUAUAGCCAAUUGAUUGUUCUAGGCCAGGUAAGAAUGGAUAUGGACAUGCAUUUAUUACCUCUUAAAAUUAUUAUUUUAAGUAAAAGCCAAUAAACAAAAACGAAAAGGCAA-3'- Poly-A tail - Coding region
DNA
DNA (Gene ID: 160364)
C-type lectin domain family 12 member A
strand +
CLL-1, MICL, CD371, DCAL-2
NCBI CDS gene sequence (798 bp)
5'-ATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGAACTCCAGTGAGATGGAAAAAATCCCAGAAATTGGCAAATTTGGGGAAAAAGCACCTCCAGCTCCCTCTCATGTATGGCGTCCAGCAGCCTTGTTTCTGACTCTTCTGTGCCTTCTGTTGCTCATTGGATTGGGAGTCTTGGCAAGCATGTTTCACGTAACTTTGAAGATAGAAATGAAAAAAATGAACAAACTACAAAACATCAGTGAAGAGCTCCAGAGAAATATTTCTCTACAACTGATGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTCCACCACACTGCAAACAATAGCCACCAAATTATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGTAAGCCTTGTCCAAGGAGATGGATTTGGCATAAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACATGGCAGGAGAGTAAAATGGCCTGTGCTGCTCAGAATGCCAGCCTGTTGAAGATAAACAACAAAAATGCATTGGAATTTATAAAATCCCAGAGTAGATCATATGACTATTGGCTGGGATTATCTCCTGAAGAAGATTCCACTCGTGGTATGAGAGTGGATAATATAATCAACTCCTCTGCCTGGGTTATAAGAAACGCACCTGACTTAAATAACATGTATTGTGGATATATAAATAGACTATATGTTCAATATTATCACTGCACTTATAAAAAAAGAATGATATGTGAGAAGATGGCCAATCCAGTGCAGCTTGGTTCTACATATTTTAGGGAGGCATGA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.
How to cite
