NCBI Summary
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_569708)
BDCA-2 - Blood Dendritic Cell Antigen 2
C-type lectin domain family 4 member C (Blood dendritic cell antigen 2) (BDCA-2) (C-type lectin superfamily member 7) (Dendritic lectin) (CD antigen CD303)
CLEC4C
C-type lectin domain family 4 member C
Curated
C-type lectin
CLEC4C
C-type - Type II transmembrane receptors
a/b mixed / C-type lectin-like
Undefined
0.396
Protein sequence and protein families (fasta) (213 amino acids) Download
MVPEEEPQDREKGLWWFQLKVWSMAVVSILLLSVCFTVSSVVPHNFMYSKTVKRLSKLREYQQYHPSLTCVMEGKDIEDWSCCPTPWTSFQSSCYFISTGMQSWTKSQKNCSVMGADLVVINTREEQDFIIQNLKRNSSYFLGLSDPGGRRHWQWVDQTPYNENVTFWHSGEPNNLDERCAIINFRSSEEWGWNDIHCHVPQKSICKMKKIYI
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Oligomerization and Known Interactions
Homodimer
Annotation
Ligand
Glycan ligands from structural data
bGal14bGlcNAc12Man
Gal(b1-4)GlcNAc(b1-2)Man
aMeMan
Man
Expression
Functionality temporarily unavailable.
References
NCBI References (10 PubMed Identifiers)
  • Zika Virus Inhibits IFN-alpha Response by Human Plasmacytoid Dendritic Cells and Induces NS1-Dependent Triggering of CD303 (BDCA-2) Signaling. [33193389]
  • A reference map of the human binary protein interactome. [32296183]
  • Re-evaluation of human BDCA-2+ DC during acute sterile skin inflammation. [31845972]
  • Effect of in vivo Hydroxychloroquine and ex vivo Anti-BDCA2 mAb Treatment on pDC IFNalpha Production From Patients Affected With Cutaneous Lupus Erythematosus. [30846987]
  • Identification of serum glycoprotein ligands for the immunomodulatory receptor blood dendritic cell antigen 2. [29796630]
  • The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
  • BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction. [11748283]
  • Molecular and genomic characterization of human DLEC, a novel member of the C-type lectin receptor gene family preferentially expressed on monocyte-derived dendritic cells. [11536172]
  • BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. [11086035]
  • Identification and characterization of the gene for a novel C-type lectin (CLECSF7) that maps near the natural killer gene complex on human chromosome 12. [11031109]
UniProt Main References (4 PubMed Identifiers)
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Human C-type lectin domain family 4, member C (CLEC4C/BDCA-2/CD303) is a receptor for asialo-galactosyl-oligosaccharides. [21880719]
  • Crystal structures of carbohydrate recognition domain of blood dendritic cell antigen-2 (BDCA2) reveal a common domain-swapped dimer. [24425442]
  • A Novel Mechanism for Binding of Galactose-terminated Glycans by the C-type Carbohydrate Recognition Domain in Blood Dendritic Cell Antigen 2. [25995448]
All isoforms of this gene containing a lectin domain
NP_987099.1, NP_001358319.1, NP_569708.1, XP_024304640.1, XP_024304641.1, NP_001358320.1, XP_016874429.1
RNA
RNA (Transcript ID: NM_130441.3)
C-type lectin domain family 4 member C, transcript variant 1
m7G-5')ppp(5'-ACUCUGUCACCCAGGCUGGAGUGAAGUGGUACGAUUACGGCUCACUGCAAUCCCUGCCUCCCAAAUUCCAGUGAUUCUCGUGCCUCAGCCUCCUGAGUAGCCGAAAUUACAGACGUGUGCCACCAUGCUUGGCUAAUUUUUUGGAUUUUUAGUAGAGAUGGGGUUUCACUAUGUUGGCCAGGCUAGUCUUGAACUCCUGGCCUGAAGCAAUCCGCCCACCUCAGCCUCCCAAAGUGCUGAGAUUAUAGGCACGAGCCACUACACCUGGCCACAAAAUUCUUUAAAGAAGCCAAUCCCAUCCUCCCUCAAGAGCCAAGGGGCCACCUCACCCUCUUGUUACAGCAGAUCCUGCCUCCCACAGUCACCCUGCUCCCAAGUGCAACCUCUGUCUGACCCUGCAUGGUGUGCGGUGCCCUCCUGCCUCAGGCCGCGAAGAAGGAUCUAAGGGCUUGGCUUGUUUGAAAGAACCACACCCCGAAAGUAACAUCUUUGGAGAAAGUGAUACAAGAGCUUCUGCACCCACCUGAUAGAGGAAGUCCAAAGGGUGUGCGCACACACAAUGGUGCCUGAAGAAGAGCCUCAAGACCGAGAGAAAGGACUCUGGUGGUUCCAGUUGAAGGUCUGGUCCAUGGCAGUCGUAUCCAUCUUGCUCCUCAGUGUCUGUUUCACUGUGAGUUCUGUGGUGCCUCACAAUUUUAUGUAUAGCAAAACUGUCAAGAGGCUGUCCAAGUUACGAGAGUAUCAACAGUAUCAUCCAAGCCUGACCUGCGUCAUGGAAGGAAAGGACAUAGAAGAUUGGAGCUGCUGCCCAACCCCUUGGACUUCAUUUCAGUCUAGUUGCUACUUUAUUUCUACUGGGAUGCAAUCUUGGACUAAGAGUCAAAAGAACUGUUCUGUGAUGGGGGCUGAUCUGGUGGUGAUCAACACCAGGGAAGAACAGGAUUUCAUCAUUCAGAAUCUGAAAAGAAAUUCUUCUUAUUUUCUGGGGCUGUCAGAUCCAGGGGGUCGGCGACAUUGGCAAUGGGUUGACCAGACACCAUACAAUGAAAAUGUCACAUUCUGGCACUCAGGUGAACCCAAUAACCUUGAUGAGCGUUGUGCGAUAAUAAAUUUCCGUUCUUCAGAAGAAUGGGGCUGGAAUGACAUUCACUGUCAUGUACCUCAGAAGUCAAUUUGCAAGAUGAAGAAGAUCUACAUAUAAAUGAAAUAUUCUCCCUGGAAAUGUGUUUGGGUUGGCAUCCACCGUUGUAGAAAGCUAAAUUGAUUUUUUAAUUUAUGUGUAAGUUUUGUACAAGGAAUGCCCCUAAAAUGUUUCAGCAGGCUGUCACCUAUUACACUUAUGAUAUAAUCCA-3'- Poly-A tail
  • Coding region
DNA
DNA (Gene ID: 170482)
C-type lectin domain family 4 member C
strand -
HECL, DLEC, BDCA2, CD303
NCBI CDS gene sequence (642 bp)
5'-ATGGTGCCTGAAGAAGAGCCTCAAGACCGAGAGAAAGGACTCTGGTGGTTCCAGTTGAAGGTCTGGTCCATGGCAGTCGTATCCATCTTGCTCCTCAGTGTCTGTTTCACTGTGAGTTCTGTGGTGCCTCACAATTTTATGTATAGCAAAACTGTCAAGAGGCTGTCCAAGTTACGAGAGTATCAACAGTATCATCCAAGCCTGACCTGCGTCATGGAAGGAAAGGACATAGAAGATTGGAGCTGCTGCCCAACCCCTTGGACTTCATTTCAGTCTAGTTGCTACTTTATTTCTACTGGGATGCAATCTTGGACTAAGAGTCAAAAGAACTGTTCTGTGATGGGGGCTGATCTGGTGGTGATCAACACCAGGGAAGAACAGGATTTCATCATTCAGAATCTGAAAAGAAATTCTTCTTATTTTCTGGGGCTGTCAGATCCAGGGGGTCGGCGACATTGGCAATGGGTTGACCAGACACCATACAATGAAAATGTCACATTCTGGCACTCAGGTGAACCCAATAACCTTGATGAGCGTTGTGCGATAATAAATTTCCGTTCTTCAGAAGAATGGGGCTGGAATGACATTCACTGTCATGTACCTCAGAAGTCAATTTGCAAGATGAAGAAGATCTACATATAA-3'
NCBI CDS gene sequence with introns (location: 7729596.. 7747348) (17753 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 7729445.. 7749541) (20097 bp)Download
NCBI gene sequence (location: [7729445.. 7749541 + 1000]) (21097 bp)Download
Cite How to cite