NCBI Summary
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_569708)
BDCA-2 - Blood Dendritic Cell Antigen 2
C-type lectin domain family 4 member C (Blood dendritic cell antigen 2) (BDCA-2) (C-type lectin superfamily member 7) (Dendritic lectin) (CD antigen CD303)
CLEC4C
C-type lectin domain family 4 member C
Curated
C-type lectin
CLEC4C
C-type - Type II transmembrane receptors
a/b mixed / C-type lectin-like
MVPEEEPQDREKGLWWFQLKVWSMAVVSILLLSVCFTVSSVVPHNFMYSKTVKRLSKLREYQQYHPSLTCVMEGKDIEDWSCCPTPWTSFQSSCYFISTGMQSWTKSQKNCSVMGADLVVINTREEQDFIIQNLKRNSSYFLGLSDPGGRRHWQWVDQTPYNENVTFWHSGEPNNLDERCAIINFRSSEEWGWNDIHCHVPQKSICKMKKIYI
Mol* PDB structure viewerUniLectin3D
Ligand
Glycan ligands from structural data
References
NCBI References (10 PubMed Identifiers)
- Zika Virus Inhibits IFN-alpha Response by Human Plasmacytoid Dendritic Cells and Induces NS1-Dependent Triggering of CD303 (BDCA-2) Signaling. [33193389]
- A reference map of the human binary protein interactome. [32296183]
- Re-evaluation of human BDCA-2+ DC during acute sterile skin inflammation. [31845972]
- Effect of in vivo Hydroxychloroquine and ex vivo Anti-BDCA2 mAb Treatment on pDC IFNalpha Production From Patients Affected With Cutaneous Lupus Erythematosus. [30846987]
- Identification of serum glycoprotein ligands for the immunomodulatory receptor blood dendritic cell antigen 2. [29796630]
- The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
- BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction. [11748283]
- Molecular and genomic characterization of human DLEC, a novel member of the C-type lectin receptor gene family preferentially expressed on monocyte-derived dendritic cells. [11536172]
- BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. [11086035]
- Identification and characterization of the gene for a novel C-type lectin (CLECSF7) that maps near the natural killer gene complex on human chromosome 12. [11031109]
UniProt Main References (4 PubMed Identifiers)
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Human C-type lectin domain family 4, member C (CLEC4C/BDCA-2/CD303) is a receptor for asialo-galactosyl-oligosaccharides. [21880719]
- Crystal structures of carbohydrate recognition domain of blood dendritic cell antigen-2 (BDCA2) reveal a common domain-swapped dimer. [24425442]
- A Novel Mechanism for Binding of Galactose-terminated Glycans by the C-type Carbohydrate Recognition Domain in Blood Dendritic Cell Antigen 2. [25995448]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_130441.3)
C-type lectin domain family 4 member C, transcript variant 1
m7G-5')ppp(5'-ACUCUGUCACCCAGGCUGGAGUGAAGUGGUACGAUUACGGCUCACUGCAAUCCCUGCCUCCCAAAUUCCAGUGAUUCUCGUGCCUCAGCCUCCUGAGUAGCCGAAAUUACAGACGUGUGCCACCAUGCUUGGCUAAUUUUUUGGAUUUUUAGUAGAGAUGGGGUUUCACUAUGUUGGCCAGGCUAGUCUUGAACUCCUGGCCUGAAGCAAUCCGCCCACCUCAGCCUCCCAAAGUGCUGAGAUUAUAGGCACGAGCCACUACACCUGGCCACAAAAUUCUUUAAAGAAGCCAAUCCCAUCCUCCCUCAAGAGCCAAGGGGCCACCUCACCCUCUUGUUACAGCAGAUCCUGCCUCCCACAGUCACCCUGCUCCCAAGUGCAACCUCUGUCUGACCCUGCAUGGUGUGCGGUGCCCUCCUGCCUCAGGCCGCGAAGAAGGAUCUAAGGGCUUGGCUUGUUUGAAAGAACCACACCCCGAAAGUAACAUCUUUGGAGAAAGUGAUACAAGAGCUUCUGCACCCACCUGAUAGAGGAAGUCCAAAGGGUGUGCGCACACACAAUGGUGCCUGAAGAAGAGCCUCAAGACCGAGAGAAAGGACUCUGGUGGUUCCAGUUGAAGGUCUGGUCCAUGGCAGUCGUAUCCAUCUUGCUCCUCAGUGUCUGUUUCACUGUGAGUUCUGUGGUGCCUCACAAUUUUAUGUAUAGCAAAACUGUCAAGAGGCUGUCCAAGUUACGAGAGUAUCAACAGUAUCAUCCAAGCCUGACCUGCGUCAUGGAAGGAAAGGACAUAGAAGAUUGGAGCUGCUGCCCAACCCCUUGGACUUCAUUUCAGUCUAGUUGCUACUUUAUUUCUACUGGGAUGCAAUCUUGGACUAAGAGUCAAAAGAACUGUUCUGUGAUGGGGGCUGAUCUGGUGGUGAUCAACACCAGGGAAGAACAGGAUUUCAUCAUUCAGAAUCUGAAAAGAAAUUCUUCUUAUUUUCUGGGGCUGUCAGAUCCAGGGGGUCGGCGACAUUGGCAAUGGGUUGACCAGACACCAUACAAUGAAAAUGUCACAUUCUGGCACUCAGGUGAACCCAAUAACCUUGAUGAGCGUUGUGCGAUAAUAAAUUUCCGUUCUUCAGAAGAAUGGGGCUGGAAUGACAUUCACUGUCAUGUACCUCAGAAGUCAAUUUGCAAGAUGAAGAAGAUCUACAUAUAAAUGAAAUAUUCUCCCUGGAAAUGUGUUUGGGUUGGCAUCCACCGUUGUAGAAAGCUAAAUUGAUUUUUUAAUUUAUGUGUAAGUUUUGUACAAGGAAUGCCCCUAAAAUGUUUCAGCAGGCUGUCACCUAUUACACUUAUGAUAUAAUCCA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 170482)
C-type lectin domain family 4 member C
strand -
HECL, DLEC, BDCA2, CD303
NCBI CDS gene sequence (642 bp)
5'-ATGGTGCCTGAAGAAGAGCCTCAAGACCGAGAGAAAGGACTCTGGTGGTTCCAGTTGAAGGTCTGGTCCATGGCAGTCGTATCCATCTTGCTCCTCAGTGTCTGTTTCACTGTGAGTTCTGTGGTGCCTCACAATTTTATGTATAGCAAAACTGTCAAGAGGCTGTCCAAGTTACGAGAGTATCAACAGTATCATCCAAGCCTGACCTGCGTCATGGAAGGAAAGGACATAGAAGATTGGAGCTGCTGCCCAACCCCTTGGACTTCATTTCAGTCTAGTTGCTACTTTATTTCTACTGGGATGCAATCTTGGACTAAGAGTCAAAAGAACTGTTCTGTGATGGGGGCTGATCTGGTGGTGATCAACACCAGGGAAGAACAGGATTTCATCATTCAGAATCTGAAAAGAAATTCTTCTTATTTTCTGGGGCTGTCAGATCCAGGGGGTCGGCGACATTGGCAATGGGTTGACCAGACACCATACAATGAAAATGTCACATTCTGGCACTCAGGTGAACCCAATAACCTTGATGAGCGTTGTGCGATAATAAATTTCCGTTCTTCAGAAGAATGGGGCTGGAATGACATTCACTGTCATGTACCTCAGAAGTCAATTTGCAAGATGAAGAAGATCTACATATAA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.