NCBI Summary
This gene encodes a type I membrane protein with a carbohydrate recognition domain characteristic of C-type lectins in its extracellular portion. In other proteins, this domain is involved in endocytosis of glycoproteins and exogenous sugar-bearing pathogens. This protein localizes predominantly to the perinuclear region. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Feb 2011].
Protein
Protein (NP_079220)
Chondrolectin
Chondrolectin (Transmembrane protein MT75)
CHODL
chondrolectin
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Type I receptors
a/b mixed / C-type lectin-like
MSRVVSLLLGAALLCGHGAFCRRVVSGQKVCFADFKHPCYKMAYFHELSSRVSFQEARLACESEGGVLLSLENEAEQKLIESMLQNLTKPGTGISDGDFWIGLWRNGDGQTSGACPDLYQWSDGSNSQYRNWYTDEPSCGSEKCVVMYHQPTANPGLGGPYLYQWNDDRCNMKHNYICKYEPEINPTAPVEKPYLTNQPGDTHQNVVVTEAGIIPNLIYVVIPTIPLLLLILVAFGTCCFQMLHKSKGRTKTSPNQSTLWISKSTRKESGMEV
No structure currently available in the PDB RCSB Databank.
Structural models
SWISS-MODEL structural models
The location of the lectin domain structural model is: 35-182
We infer [1.59, 2.06] Å as the interval of error of this structural model.
Template 1: 3VYK chain: A, Q5YIR8, NP_001005860.1, sequence identity: 25.7%, coverage: 82.4%, location in sequence: 106-233, (106-233 in PDB).
Template 2: 7L67 chain: A, P22897, NP_002429.1, sequence identity: 25.7%, coverage: 81.8%, location in sequence: 659-779, (641-761 in PDB).
Template 3: 6LFJ chain: A, Q9D8Q7, NP_081494.1, sequence identity: 25.0%, coverage: 81.1%, location in sequence: 42-174, (75-207 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
We infer [1.59, 2.06] Å as the interval of error of this structural model.
Template 1: 3VYK chain: A, Q5YIR8, NP_001005860.1, sequence identity: 25.7%, coverage: 82.4%, location in sequence: 106-233, (106-233 in PDB).
Template 2: 7L67 chain: A, P22897, NP_002429.1, sequence identity: 25.7%, coverage: 81.8%, location in sequence: 659-779, (641-761 in PDB).
Template 3: 6LFJ chain: A, Q9D8Q7, NP_081494.1, sequence identity: 25.0%, coverage: 81.1%, location in sequence: 42-174, (75-207 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- A reference map of the human binary protein interactome. [32296183]
- Genome-wide association study combining pathway analysis for typical sporadic amyotrophic lateral sclerosis in Chinese Han populations. [24529757]
- Genetic variants associated with disordered eating. [23568457]
- Genome-wide association study of chemotherapeutic agent-induced severe neutropenia/leucopenia for patients in Biobank Japan. [23648065]
- Antibody-based protein profiling of the human chromosome 21. [22042635]
- Expression and localization of CHODLDeltaE/CHODLfDeltaE, the soluble isoform of chondrolectin. [17606388]
- The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
- A novel alternative spliced chondrolectin isoform lacking the transmembrane domain is expressed during T cell maturation. [12621022]
- Molecular cloning and characterization of human chondrolectin, a novel type I transmembrane protein homologous to C-type lectins. [12079284]
- From PREDs and open reading frames to cDNA isolation: revisiting the human chromosome 21 transcription map. [11707072]
UniProt Main References (3 PubMed Identifiers)
- Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
- The DNA sequence of human chromosome 21. [10830953]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_024944.3)
m7G-5')ppp(5'-GCUGCUGCUGUGAUCCAGGACCAGGGCGCACCGGCUCAGCCUCUCACUUGUCAGAGGCCGGGGAAGAGAAGCAAAGCGCAACGGUGUGGUCCAAGCCGGGGCUUCUGCUUCGCCUCUAGGACAUACACGGGACCCCCUAACUUCAGUCCCCCAAACGCGCACCCUCGAAGUCUUGAACUCCAGCCCCGCACAUCCACGCGCGGCACAGGCGCGGCAGGCGGCAGGUCCCGGCCGAAGGCGAUGCGCGCAGGGGGUCGGGCAGCUGGGCUCGGGCGGCGGGAGUAGGGCCCGGCAGGGAGGCAGGGAGGCUGCAGAGUCAGAGUCGCGGGCUGCGCCCUGGGCAGAGGCCGCCCUCGCUCCACGCAACACCUGCUGCUGCCACCGCGCCGCGAUGAGCCGCGUGGUCUCGCUGCUGCUGGGCGCCGCGCUGCUCUGCGGCCACGGAGCCUUCUGCCGCCGCGUGGUCAGCGGCCAAAAGGUGUGUUUUGCUGACUUCAAGCAUCCCUGCUACAAAAUGGCCUACUUCCAUGAACUGUCCAGCCGAGUGAGCUUUCAGGAGGCACGCCUGGCUUGUGAGAGUGAGGGAGGAGUCCUCCUCAGCCUUGAGAAUGAAGCAGAACAGAAGUUAAUAGAGAGCAUGUUGCAAAACCUGACAAAACCCGGGACAGGGAUUUCUGAUGGUGAUUUCUGGAUAGGGCUUUGGAGGAAUGGAGAUGGGCAAACAUCUGGUGCCUGCCCAGAUCUCUACCAGUGGUCUGAUGGAAGCAAUUCCCAGUACCGAAACUGGUACACAGAUGAACCUUCCUGCGGAAGUGAAAAGUGUGUUGUGAUGUAUCACCAACCAACUGCCAAUCCUGGCCUUGGGGGUCCCUACCUUUACCAGUGGAAUGAUGACAGGUGUAACAUGAAGCACAAUUAUAUUUGCAAGUAUGAACCAGAGAUUAAUCCAACAGCCCCUGUAGAAAAGCCUUAUCUUACAAAUCAACCAGGAGACACCCAUCAGAAUGUGGUUGUUACUGAAGCAGGUAUAAUUCCCAAUCUAAUUUAUGUUGUUAUACCAACAAUACCCCUGCUCUUACUGAUACUGGUUGCUUUUGGAACCUGUUGUUUCCAGAUGCUGCAUAAAAGUAAAGGAAGAACAAAAACUAGUCCAAACCAGUCUACACUGUGGAUUUCAAAGAGUACCAGAAAAGAAAGUGGCAUGGAAGUAUAAUAACUCAUUGACUUGGUUCCAGAAUUUUGUAAUUCUGGAUCUGUAUAAGGAAUGGCAUCAGAACAAUAGCUUGGAAUGGCUUGAAAUCACAAAGGAUCUGCAAGAUGAACUGUAAGCUCCCCCUUGAGGCAAAUAUUAAAGUAAUUUUUAUAUGUCUAUUAUUUCAUUUAAAGAAUAUGCUGUGCUAAUAAUGGAGUGAGACAUGCUUAUUUUGCUAAAGGAUGCACCCAAACUUCAAACUUCAAGCAAAUGAAAUGGACAAUGCAGAUAAAGUUGUUAUCAACACGUCGGGAGUAUGUGUGUUAGAAGCAAUUCCUUUUAUUUCUUUCACCUUUCAUAAGUUGUUAUCUAGUCAAUGUAAUGUAUAUUGUAUUGAAAUUUACAGUGUGCAAAAGUAUUUUACCUUUGCAUAAGUGUUUGAUAAAAAUGAACUGUUCUAAUAUUUAUUUUUAUGGCAUCUCAUUUUUCAAUACAUGCUCUUUUGAUUAAAGAAACUUAUUACUGUUGUCAACUGAAUUCACACACACACAAAUAUAGUACCAUAGAAAAAGUUUGUUUUCUCGAAAUAAUUCAUCUUUCAGCUUCUCUGCUUUUGGUCAAUGUCUAGGAAAUCUCUUCAGAAAUAAGAAGCUAUUUCAUUAAGUGUGAUAUAAACCUCCUCAAACAUUUUACUUAGAGGCAAGGAUUGUCUAAUUUCAAUUGUGCAAGACAUGUGCCUUAUAAUUAUUUUUAGCUUAAAAUUAAACAGAUUUUGUAAUAAUGUAACUUUGUUAAUAGGUGCAUAAACACUAAUGCAGUCAAUUUGAACAAAAGAAGUGACAUACACAAUAUAAAUCAUAUGUCUUCACACGUUGCCUAUAUAAUGAGAAGCAGCUCUCUGAGGGUUCUGAAAUCAAUGUGGUCCCUCUCUUGCCCACUAAACAAAGAUGGUUGUUCGGGGUUUGGGAUUGACACUGGAGGCAGAUAGUUGCAAAGUUAGUCUAAGGUUUCCCUAGCUGUAUUUAGCCUCUGACUAUAUUAGUAUACAAAGAGGUCAUGUGGUUGAGACCAGGUGAAUAGUCACUAUCAGUGUGGAGACAAGCACAGCACACAGACAUUUUAGGAAGGAAAGGAACUACGAAAUCGUGUGAAAAUGGGUUGGAACCCAUCAGUGAUCGCAUAUUCAUUGAUGAGGGUUUGCUUGAGAUAGAAAAUGGUGGCUCCUUUCUGUCUUAUCUCCUAGUUUCUUCAAUGCUUACGCCUUGUUCUUCUCAAGAGAAAGUUGUAACUCUCUGGUCUUCAUAUGUCCCUGUGCUCCUUUUAACCAAAUAAAGAGUUCUUGUUUCUGAAGAA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 140578)
chondrolectin
strand +
FLJ12627, PRED12, MT75
NCBI CDS gene sequence (822 bp)
5'-ATGAGCCGCGTGGTCTCGCTGCTGCTGGGCGCCGCGCTGCTCTGCGGCCACGGAGCCTTCTGCCGCCGCGTGGTCAGCGGCCAAAAGGTGTGTTTTGCTGACTTCAAGCATCCCTGCTACAAAATGGCCTACTTCCATGAACTGTCCAGCCGAGTGAGCTTTCAGGAGGCACGCCTGGCTTGTGAGAGTGAGGGAGGAGTCCTCCTCAGCCTTGAGAATGAAGCAGAACAGAAGTTAATAGAGAGCATGTTGCAAAACCTGACAAAACCCGGGACAGGGATTTCTGATGGTGATTTCTGGATAGGGCTTTGGAGGAATGGAGATGGGCAAACATCTGGTGCCTGCCCAGATCTCTACCAGTGGTCTGATGGAAGCAATTCCCAGTACCGAAACTGGTACACAGATGAACCTTCCTGCGGAAGTGAAAAGTGTGTTGTGATGTATCACCAACCAACTGCCAATCCTGGCCTTGGGGGTCCCTACCTTTACCAGTGGAATGATGACAGGTGTAACATGAAGCACAATTATATTTGCAAGTATGAACCAGAGATTAATCCAACAGCCCCTGTAGAAAAGCCTTATCTTACAAATCAACCAGGAGACACCCATCAGAATGTGGTTGTTACTGAAGCAGGTATAATTCCCAATCTAATTTATGTTGTTATACCAACAATACCCCTGCTCTTACTGATACTGGTTGCTTTTGGAACCTGTTGTTTCCAGATGCTGCATAAAAGTAAAGGAAGAACAAAAACTAGTCCAAACCAGTCTACACTGTGGATTTCAAAGAGTACCAGAAAAGAAAGTGGCATGGAAGTATAA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.